🧬 RiceVarMap AI Assistant

Intelligent assistant for database queries and knowledge Q&A

🔍 Query Mode

Query variation information for vg0722097923
Search for SNP variants at positions 2000 to 8000 on chromosome 1.
Design primers for vg0722097923
Design primers for the chr01:10000-20000 region
View expression levels and variant information for variants within 5 kb upstream and downstream of gene LOC_Os01g08570.
Align these sequences to the MSU7 genome: ATGTCGAACGAGGTGAACCATGTAGG, GAAGGCTCCCATGTTTAATGGCAC
View GWAS results for agronomic traits related to heading date
Query the genotype of vg0722097923 in Nipponbare and 9311
Analysis vg0122375601, vg0122375884, vg0122375947, vg0122375984, vg0122376428, vg0122376434, vg0122376511 haplotype analysis
Query FST and π values for gene LOC_Os01g02090 in All_Indica and All_Japonica
Find variants associated with grain length trait
View the genotype information for vg0500004123, vg0500073814, and vg0500152745 in the three varieties Nipponbare, Minghui63, and Zhenshan97B
👋

Welcome to RiceVarMap AI Assistant

Click examples on the left/right or type your query below

💡 Q&A Mode

What is Basenji score and how is it calculated?
What is the difference between FST and π?
How does the primer design module work?
What functions can RiceVarMap achieve?
How to interpret GWAS results?
What rice varieties are included in the database?
How to use the BLAST function?
What is a haplotype network?
Explain the concept of nucleotide diversity
What are the main rice subspecies in the database?
How to download variant data?
What is the coverage of the genome sequencing?