RiceVarMap v3.0

RiceVarMap v3 REST API

The RiceVarMap v3 REST API provides programmatic access to reference metadata, cultivar catalogs, variants, gene metadata, gene-region variants, coordinate conversion cache, primer design, and genotype queries. Responses use a stable JSON object with ok, data, meta, and error.

Overview

Base URL

https://ricevarmap.ncpgr.cn/v3/api

Request Conventions

GET endpoints accept query-string parameters.
POST endpoints accept a JSON object with Content-Type: application/json.
All successful and failed responses use the same envelope: ok, data, meta, and error.
Response samples are shortened when arrays are long, but field names and nesting match the live API.
Coordinates are 1-based and chromosome names use chr01 through chr12.

Endpoint Index

Method	Path	Purpose
`GET`	`/health`	Service health check.
`GET`	`/references`	Supported references: NIP, ZS97, and MH63.
`GET`	`/populations`	Population code and label whitelist.
`GET`	`/cultivars`	Cultivar metadata with optional search and filters.
`POST`	`/cultivars/batch`	Batch cultivar metadata lookup.
`GET`	`/variants/<var_id>`	Variant detail and frequency data.
`POST`	`/variants/batch`	Batch variant detail and frequency query.
`GET`	`/variants/by-region`	Region-based variant search.
`GET`	`/genes/<gene_id>`	Gene metadata.
`POST`	`/genes/batch`	Batch gene metadata lookup.
`GET`	`/genes/search`	Gene search by ID, transcript ID, or annotation text.
`GET`	`/genes/<gene_id>/variants`	Variants in a gene-centered interval.
`GET`	`/coordinates/convert`	Cache-only coordinate conversion by variation ID.
`POST`	`/coordinates/convert/batch`	Batch cache-only coordinate conversion.
`POST`	`/primers/by-id`	Primer design for a variation ID.
`POST`	`/genotypes/query`	Genotypes for selected variants and cultivars.

Endpoints by Method

GET Endpoints

GET endpoints use query-string parameters and are intended for read-only metadata, search, variant lookup, and cache lookup operations.

`GET /health`

Parameter	Required	Type	Description
No parameters.

Request Example

curl -s 'https://ricevarmap.ncpgr.cn/v3/api/health'

Response Sample

{
  "ok": true,
  "data": {
    "service": "ricevarmap3",
    "status": "ok"
  },
  "meta": {"api_version": "v3"},
  "error": null
}

`GET /references`

Parameter	Required	Type	Description
No parameters.

Request Example

curl -s 'https://ricevarmap.ncpgr.cn/v3/api/references'

Response Sample

{
  "ok": true,
  "data": {
    "references": [
      {"id": "NIP", "label": "Nipponbare / IRGSP-1.0", "variant_prefix": "vg", "supports_str": true},
      {"id": "ZS97", "label": "ZS97RS3", "variant_prefix": "vz", "supports_str": false},
      {"id": "MH63", "label": "MH63RS3", "variant_prefix": "vm", "supports_str": false}
    ]
  },
  "meta": {"api_version": "v3"},
  "error": null
}

`GET /populations`

Parameter	Required	Type	Description
No parameters.

Request Example

curl -s 'https://ricevarmap.ncpgr.cn/v3/api/populations'

Response Sample

{
  "ok": true,
  "data": {
    "populations": [
      {"code": "All", "label": "All"},
      {"code": "Ind_All", "label": "All Indica"},
      {"code": "Jap_All", "label": "All Japonica"},
      {"code": "TeJ", "label": "Temperate Japonica"},
      {"code": "TrJ", "label": "Tropical Japonica"}
    ]
  },
  "meta": {"api_version": "v3"},
  "error": null
}

`GET /cultivars`

Parameter	Required	Type	Description
`q`	No	string	Search by cultivar ID, name, subpopulation, or location. Maximum length: 100 characters.
`subpopulation`	No	string	Exact subpopulation code filter, such as `TeJ`, `IndI`, or `Aus`. Use `All` or omit it for all cultivars.
`location`	No	string	Location text filter, such as `China`. Maximum length: 100 characters.
`limit`	No	integer	Number of rows to return. Default: 100. Maximum: 1000.
`offset`	No	integer	Zero-based pagination offset. Default: 0.

Request Example

curl -s 'https://ricevarmap.ncpgr.cn/v3/api/cultivars?q=Heibiao&subpopulation=TeJ&location=China&limit=1'

Response Sample

{
  "ok": true,
  "data": {
    "cultivars": [
      {
        "id_name": "B001",
        "name": "Heibiao",
        "subpopulation": "TeJ",
        "location": "China",
        "longitude": null,
        "latitude": null
      }
    ],
    "count": 4726,
    "limit": 1,
    "offset": 0
  },
  "meta": {"api_version": "v3"},
  "error": null
}

`GET /variants/<var_id>`

Parameter	Required	Type	Description
`var_id`	Yes	path string	Variant ID such as `vg0100001306`, `vz0100013877`, `vm0100005869`, or `STR0100000001`.
`include`	No	string	Comma-separated sections. Allowed values: `basic`, `frequency`. Default: `basic,frequency`.
`population`	No	string	Return frequency for one population only. Allowed population codes include `All`, `Ind_All`, `Jap_All`, `TeJ`, and `TrJ`. Omit it to return all populations.

Request Example

curl -s 'https://ricevarmap.ncpgr.cn/v3/api/variants/vg0100001306?include=basic,frequency&population=All'

Response Sample

{
  "ok": true,
  "data": {
    "variant": {
      "var_id": "vg0100001306",
      "reference": "NIP",
      "chr": "chr01",
      "pos": 1306,
      "type": "SNP",
      "ref": "G",
      "alt": "A"
    },
    "frequency": [
      {
        "population": "All",
        "major_genotype": "G",
        "minor_genotype": "A",
        "major_rate": 0.984,
        "minor_rate": 0.015,
        "count": 4726
      }
    ]
  },
  "meta": {"api_version": "v3"},
  "error": null
}

`GET /variants/by-region`

Parameter	Required	Type	Description
`reference`	No	string	Reference genome. Allowed values: `NIP`, `ZS97`, `MH63`. Default: `NIP`.
`chr`	Yes	string	Chromosome name from `chr01` to `chr12`.
`start`	Yes	integer	Start coordinate, minimum 1.
`end`	Yes	integer	End coordinate, greater than `start`. Maximum interval length: 100000 bp.
`type`	No	string	Allowed values: `All`, `SNP`, `INDEL`, `STR`. Default: `All`. STR is available only for NIP.
`population`	No	string	Frequency population used for each returned variant. Default: `All`.
`limit`	No	integer	Default: 100. Maximum: 1000.
`offset`	No	integer	Default: 0.

Request Example

curl -s 'https://ricevarmap.ncpgr.cn/v3/api/variants/by-region?reference=NIP&chr=chr01&start=10000&end=20000&population=All&limit=1'

Response Sample

{
  "ok": true,
  "data": {
    "variants": [
      {
        "var_id": "vg0100010532",
        "reference": "NIP",
        "chr": "chr01",
        "pos": 10532,
        "type": "SNP",
        "ref": "G",
        "alt": "T",
        "population": "All",
        "major_genotype": "G",
        "minor_genotype": "T",
        "major_rate": 0.995,
        "minor_rate": 0.005,
        "count": 4726
      }
    ],
    "count": 164,
    "limit": 1,
    "offset": 0,
    "reference": "NIP",
    "chr": "chr01",
    "start": 10000,
    "end": 20000,
    "type": "All",
    "population": "All"
  },
  "meta": {"api_version": "v3"},
  "error": null
}

`GET /genes/<gene_id>`

Parameter	Required	Type	Description
`gene_id`	Yes	path string	Gene ID. NIP examples use `LOC_Os`; ZS97 IDs start with `OsZS`; MH63 IDs start with `OsMH`.

Request Example

curl -s 'https://ricevarmap.ncpgr.cn/v3/api/genes/LOC_Os05g32860'

Response Sample

{
  "ok": true,
  "data": {
    "gene": {
      "gene_id": "LOC_Os05g32860",
      "transcript_id": "LOC_Os05g32860.1",
      "reference": "NIP",
      "chr": "chr05",
      "start": 19240767,
      "end": 19241433,
      "strand": "+",
      "note": "expressed protein"
    }
  },
  "meta": {"api_version": "v3"},
  "error": null
}

`GET /genes/search`

Parameter	Required	Type	Description
`q`	Yes	string	Search text for gene ID, transcript ID, or annotation. Maximum length: 100 characters.
`reference`	No	string	Reference genome. Allowed values: `NIP`, `ZS97`, `MH63`. Default: `NIP`.
`limit`	No	integer	Default: 100. Maximum: 1000.
`offset`	No	integer	Default: 0.

Request Example

curl -s 'https://ricevarmap.ncpgr.cn/v3/api/genes/search?reference=NIP&q=LOC_Os05g32860&limit=5'

Response Sample

{
  "ok": true,
  "data": {
    "genes": [
      {
        "gene_id": "LOC_Os05g32860",
        "transcript_id": "LOC_Os05g32860.1",
        "reference": "NIP",
        "chr": "chr05",
        "start": 19240767,
        "end": 19241433,
        "strand": "+",
        "note": "expressed protein"
      }
    ],
    "count": 1,
    "limit": 5,
    "offset": 0,
    "reference": "NIP",
    "q": "LOC_Os05g32860"
  },
  "meta": {"api_version": "v3"},
  "error": null
}

`GET /genes/<gene_id>/variants`

Parameter	Required	Type	Description
`gene_id`	Yes	path string	Gene ID. NIP examples use `LOC_Os`; ZS97 IDs start with `OsZS`; MH63 IDs start with `OsMH`.
`up`	No	integer	Upstream flank length. Default: 2000. Range: 0-10000.
`down`	No	integer	Downstream flank length. Default: 1000. Range: 0-10000.
`population`	No	string	Frequency population used for each returned variant. Default: `All`.
`limit`	No	integer	Default: 100. Maximum: 1000.
`offset`	No	integer	Default: 0.

Request Example

curl -s 'https://ricevarmap.ncpgr.cn/v3/api/genes/LOC_Os05g32860/variants?up=2000&down=1000&population=All&limit=1'

Response Sample

{
  "ok": true,
  "data": {
    "gene": {
      "gene_id": "LOC_Os05g32860",
      "transcript_id": "LOC_Os05g32860.1",
      "reference": "NIP",
      "chr": "chr05",
      "start": 19240767,
      "end": 19241433,
      "strand": "+",
      "note": "expressed protein"
    },
    "population": "All",
    "query_interval": {
      "chr": "chr05",
      "start": 19238767,
      "end": 19242433,
      "up": 2000,
      "down": 1000
    },
    "variants": [],
    "count": 71,
    "limit": 1,
    "offset": 0
  },
  "meta": {"api_version": "v3"},
  "error": null
}

`GET /coordinates/convert`

Parameter	Required	Type	Description
`var_id`	Yes	string	Variant ID to convert through the coordinate-conversion cache.
`cache_only`	No	boolean	Only `true` is currently supported. Default: `true`.

Request Example

curl -s 'https://ricevarmap.ncpgr.cn/v3/api/coordinates/convert?var_id=vg0100001306&cache_only=true'

Response Sample

{
  "ok": true,
  "data": {
    "var_id": "vg0100001306",
    "reference": "NIP",
    "source_genome": "nip",
    "rows": [
      {
        "window_label": "Up 100bp",
        "nip_id": "vg0100001306",
        "zs_id": "vm0100005869",
        "mh_id": "NA"
      }
    ]
  },
  "meta": {"api_version": "v3"},
  "error": null
}

POST Endpoints

POST endpoints accept a JSON object in the request body. They are used for batch operations, primer design, and genotype queries.

`POST /cultivars/batch`

JSON field	Required	Type	Description
`cultivars`	Yes	array	Cultivar IDs such as `B001` or `C145`. Maximum: 500 IDs.

Request Example

curl -s -X POST 'https://ricevarmap.ncpgr.cn/v3/api/cultivars/batch' \
  -H 'Content-Type: application/json' \
  -d '{"cultivars":["B001","C145"]}'

Response Sample

{
  "ok": true,
  "data": {
    "results": [
      {
        "id_name": "B001",
        "name": "Heibiao",
        "subpopulation": "TeJ",
        "location": "China",
        "longitude": null,
        "latitude": null
      }
    ],
    "count": 1,
    "used_cultivars": ["B001"],
    "not_found": []
  },
  "meta": {"api_version": "v3"},
  "error": null
}

`POST /variants/batch`

JSON field	Required	Type	Description
`var_ids`	Yes	array	Variant IDs. Maximum: 500 IDs for `basic`-only requests, or 200 IDs when `frequency` is included.
`include`	No	string or array	Allowed values: `basic`, `frequency`. Default: `basic,frequency`.
`population`	No	string	Return frequency for one population only. Omit it to return all populations.

Request Example

curl -s -X POST 'https://ricevarmap.ncpgr.cn/v3/api/variants/batch' \
  -H 'Content-Type: application/json' \
  -d '{"var_ids":["vg0100001306","vg0701959554"],"include":["basic","frequency"],"population":"All"}'

Response Sample

{
  "ok": true,
  "data": {
    "results": [
      {
        "var_id": "vg0100001306",
        "reference": "NIP",
        "variant": {
          "var_id": "vg0100001306",
          "reference": "NIP",
          "chr": "chr01",
          "pos": 1306,
          "type": "SNP",
          "ref": "G",
          "alt": "A"
        },
        "frequency": [
          {"population": "All", "major_genotype": "G", "minor_genotype": "A", "major_rate": 0.984}
        ]
      }
    ],
    "count": 1,
    "used_variants": ["vg0100001306"],
    "not_found": [],
    "include": ["basic", "frequency"],
    "population": "All"
  },
  "meta": {"api_version": "v3"},
  "error": null
}

`POST /genes/batch`

JSON field	Required	Type	Description
`gene_ids`	Yes	array	Gene IDs. Maximum: 200 IDs. NIP examples use `LOC_Os`; ZS97 IDs start with `OsZS`; MH63 IDs start with `OsMH`.

Request Example

curl -s -X POST 'https://ricevarmap.ncpgr.cn/v3/api/genes/batch' \
  -H 'Content-Type: application/json' \
  -d '{"gene_ids":["LOC_Os05g32860","LOC_Os01g01010"]}'

Response Sample

{
  "ok": true,
  "data": {
    "results": [
      {
        "gene_id": "LOC_Os05g32860",
        "transcript_id": "LOC_Os05g32860.1",
        "reference": "NIP",
        "chr": "chr05",
        "start": 19240767,
        "end": 19241433,
        "strand": "+",
        "note": "expressed protein"
      }
    ],
    "count": 1,
    "used_genes": ["LOC_Os05g32860"],
    "not_found": []
  },
  "meta": {"api_version": "v3"},
  "error": null
}

`POST /coordinates/convert/batch`

JSON field	Required	Type	Description
`var_ids`	Yes	array	Variant IDs to convert through the coordinate-conversion cache. Maximum: 500 IDs.
`cache_only`	No	boolean	Only `true` is currently supported. Default: `true`.

Request Example

curl -s -X POST 'https://ricevarmap.ncpgr.cn/v3/api/coordinates/convert/batch' \
  -H 'Content-Type: application/json' \
  -d '{"var_ids":["vg0100001306","vg0701959554"],"cache_only":true}'

Response Sample

{
  "ok": true,
  "data": {
    "results": [
      {
        "var_id": "vg0100001306",
        "reference": "NIP",
        "source_genome": "nip",
        "rows": [
          {"window_label": "Up 100bp", "nip_id": "vg0100001306", "zs_id": "vm0100005869", "mh_id": "NA"}
        ]
      }
    ],
    "count": 1,
    "used_variants": ["vg0100001306"],
    "not_found": [],
    "cache_only": true
  },
  "meta": {"api_version": "v3"},
  "error": null
}

`POST /primers/by-id`

JSON field	Required	Type	Description
`var_id`	Yes	string	Variant ID for primer design.
`up`	No	integer	Upstream window size. Default: 100. Range: 0-10000.
`down`	No	integer	Downstream window size. Default: 100. Range: 0-10000. `up + down` must be <= 20000.
`product_size_range`	No	string	Comma-separated ranges such as `100-300,300-600,600-1000`. Default: `100-300,300-600,600-1000`.

Request Example

curl -s -X POST 'https://ricevarmap.ncpgr.cn/v3/api/primers/by-id' \
  -H 'Content-Type: application/json' \
  -d '{"var_id":"vg0701959554","up":100,"down":100,"product_size_range":"100-300,300-600,600-1000"}'

Response Sample

{
  "ok": true,
  "data": {
    "var_id": "vg0701959554",
    "reference": "NIP",
    "chr": "chr07",
    "start": 1959454,
    "end": 1959654,
    "target": "100,1",
    "excluded_count": 4,
    "variant": {
      "var_id": "vg0701959554",
      "reference": "NIP",
      "chr": "chr07",
      "pos": 1959554,
      "type": "SNP",
      "ref": "T",
      "alt": "G"
    },
    "primers": [
      {
        "index": 0,
        "left": {"sequence": "CCACAGTTTGGGTTGGATGG", "start": 1959499, "length": 20, "tm": "59.032"},
        "right": {"sequence": "GCCCAAACTCATCGACTGAC", "start": 1959639, "length": 20, "tm": "58.920"},
        "product_size": "141"
      }
    ]
  },
  "meta": {"api_version": "v3"},
  "error": null
}

`POST /genotypes/query`

JSON field	Required	Type	Description
`var_ids`	Yes	array	NIP `vg` variant IDs. Maximum: 200 IDs. STR, ZS97, and MH63 genotype queries are not supported yet.
`cultivars`	Yes	array	Cultivar IDs such as `B001` or `C145`. Maximum: 200 IDs. The request matrix `var_ids * cultivars` must be <= 20000.

Request Example

curl -s -X POST 'https://ricevarmap.ncpgr.cn/v3/api/genotypes/query' \
  -H 'Content-Type: application/json' \
  -d '{"var_ids":["vg0100001306"],"cultivars":["B001","C145"]}'

Response Sample

{
  "ok": true,
  "data": {
    "results": [
      {
        "variant": {
          "var_id": "vg0100001306",
          "reference": "NIP",
          "chr": "chr01",
          "pos": 1306,
          "type": "SNP",
          "ref": "G",
          "alt": "A",
          "major_genotype": "G",
          "minor_genotype": "A"
        },
        "genotypes": {
          "B001": {"imputed": "G", "raw": "G"},
          "C145": {"imputed": "G", "raw": "G"}
        }
      }
    ],
    "count": 1,
    "used_variants": ["vg0100001306"],
    "not_found": []
  },
  "meta": {"api_version": "v3"},
  "error": null
}

API Reference

Response Format

{
  "ok": true,
  "data": {},
  "meta": {
    "api_version": "v3"
  },
  "error": null
}

{
  "ok": false,
  "data": null,
  "meta": {
    "api_version": "v3"
  },
  "error": {
    "code": "INVALID_PARAMETER",
    "message": "Invalid parameter."
  }
}

Error Codes

Code	HTTP	Meaning
`METHOD_NOT_ALLOWED`	405	The endpoint was called with the wrong HTTP method.
`MISSING_PARAMETER`	400	A required path, query, or JSON field is missing.
`INVALID_PARAMETER`	400	A parameter has the wrong type, range, or format.
`INVALID_CHROM`	400	Chromosome must be `chr01` through `chr12`.
`INVALID_REFERENCE`	400	Reference must be `NIP`, `ZS97`, or `MH63`.
`INVALID_POPULATION`	400	Population must be one of the supported RiceVarMap population codes.
`INVALID_VARIANT_ID`	400	Variant ID does not match a supported RiceVarMap v3 ID format.
`INVALID_GENE_ID`	400	Gene ID contains unsupported characters.
`UNSUPPORTED_INCLUDE`	400	`include` contains a section that is not supported.
`LIMIT_TOO_LARGE`	400	`limit` is greater than 1000.
`REGION_TOO_LARGE`	400	The requested interval is larger than 100000 bp.
`REQUEST_TOO_LARGE`	413	POST body is larger than 1 MB.
`UNSUPPORTED_VARIANT_TYPE`	400	The requested variant type or genotype mode is not currently supported.
`NOT_FOUND`	404	The requested variant, gene, sequence interval, or genotype record was not found.
`CACHE_MISS`	404	No coordinate-conversion cache record is available for the variant.
`INTERNAL_ERROR`	500	An unexpected server-side error occurred.

Request Limits

These limits are enforced to keep interactive queries responsive and to protect shared server resources. Split larger jobs into multiple requests or use project-specific offline workflows for heavy analyses.

Item	Limit
Pagination	`limit` defaults to 100 and must be <= 1000. `offset` defaults to 0.
Cultivar batch query	Maximum 500 `cultivars` per `/cultivars/batch` request.
Variant batch query	Maximum 500 `var_ids` for basic-only `/variants/batch` requests; maximum 200 when `frequency` is included.
Gene batch query	Maximum 200 `gene_ids` per `/genes/batch` request.
Coordinate batch query	Maximum 500 `var_ids` per `/coordinates/convert/batch` request.
Region interval	`end` must be greater than `start`; interval length must be <= 100000 bp.
Chromosomes	`chr01` through `chr12`.
Gene flank sizes	`up` and `down` are 0-10000.
Primer window	`up` and `down` are 0-10000, and `up + down` must be <= 20000.
Genotype query size	Maximum 200 `var_ids`, 200 `cultivars`, and `var_ids * cultivars` <= 20000 per request.
POST body	Maximum 1 MB.
Cultivar search and filters	`q`, `subpopulation`, and `location` must be 100 characters or fewer.
Gene search	`q` is required and must be 100 characters or fewer.
STR support	STR region and detail queries are available for NIP only.
Genotype support	The genotype endpoint currently supports NIP `vg` IDs only.

Python Example

import requests

BASE = "https://ricevarmap.ncpgr.cn/v3/api"

# GET example: search variants in a genomic region.
get_response = requests.get(
    f"{BASE}/variants/by-region",
    params={
        "reference": "NIP",
        "chr": "chr01",
        "start": 10000,
        "end": 20000,
        "limit": 10,
    },
    timeout=30,
)
get_response.raise_for_status()
print(get_response.json()["data"]["variants"])

# POST example: query multiple variants by ID.
post_response = requests.post(
    f"{BASE}/variants/batch",
    json={
        "var_ids": ["vg0100001306", "vg0701959554"],
        "include": ["basic", "frequency"],
        "population": "All",
    },
    timeout=30,
)
post_response.raise_for_status()
print(post_response.json()["data"]["results"])

R Example

library(httr)
library(jsonlite)

base <- "https://ricevarmap.ncpgr.cn/v3/api"

res <- GET(
  paste0(base, "/variants/by-region"),
  query = list(reference = "NIP", chr = "chr01", start = 10000, end = 20000, limit = 10)
)
stop_for_status(res)
data <- fromJSON(content(res, as = "text", encoding = "UTF-8"))
print(data$data$variants)

res <- GET(
  paste0(base, "/genes/search"),
  query = list(reference = "NIP", q = "LOC_Os05g32860", limit = 5)
)
stop_for_status(res)
data <- fromJSON(content(res, as = "text", encoding = "UTF-8"))
print(data$data$genes)

res <- POST(
  paste0(base, "/variants/batch"),
  body = list(
    var_ids = list("vg0100001306", "vg0701959554"),
    include = list("basic", "frequency"),
    population = "All"
  ),
  encode = "json"
)
stop_for_status(res)
data <- fromJSON(content(res, as = "text", encoding = "UTF-8"))
print(data$data$results)

res <- POST(
  paste0(base, "/genotypes/query"),
  body = list(var_ids = list("vg0100001306"), cultivars = list("B001", "C145")),
  encode = "json"
)
stop_for_status(res)
data <- fromJSON(content(res, as = "text", encoding = "UTF-8"))
print(data$data$results)

IDs and References

Reference	Label	Variant prefix	STR
`NIP`	Nipponbare / IRGSP-1.0	`vg`	Yes
`ZS97`	ZS97RS3	`vz`	No
`MH63`	MH63RS3	`vm`	No

Variant IDs follow vg|vz|vm + chromosome + 8-digit position, for example vg0100001306.
STR IDs use STR + chromosome + 8-digit position, for example STR0100000001.
Gene IDs starting with OsZS are treated as ZS97, IDs starting with OsMH are treated as MH63, and other gene IDs are treated as NIP.
Population codes include All, Ind_All, Jap_All, Aus, IndI, IndII, IndIII, TeJ, TrJ, VI, Admix, Ind_Admix, and Jap_Admix.

RiceVarMap v3 REST API

Overview

Base URL

Request Conventions

Endpoint Index

Endpoints by Method

GET Endpoints

GET /health

GET /references

GET /populations

GET /cultivars

GET /variants/<var_id>

GET /variants/by-region

GET /genes/<gene_id>

GET /genes/search

GET /genes/<gene_id>/variants

GET /coordinates/convert

POST Endpoints

POST /cultivars/batch

POST /variants/batch

POST /genes/batch

POST /coordinates/convert/batch

POST /primers/by-id

POST /genotypes/query

API Reference

Response Format

Error Codes

Request Limits

Python Example

R Example

IDs and References

Navigation

`GET /health`

`GET /references`

`GET /populations`

`GET /cultivars`

`GET /variants/<var_id>`

`GET /variants/by-region`

`GET /genes/<gene_id>`

`GET /genes/search`

`GET /genes/<gene_id>/variants`

`GET /coordinates/convert`

`POST /cultivars/batch`

`POST /variants/batch`

`POST /genes/batch`

`POST /coordinates/convert/batch`

`POST /primers/by-id`

`POST /genotypes/query`