16 variations found. LOC_Os11g44510 (expressed protein), ranging from 26,921,416 bp to 26,921,790 bp (including 0 kb upstream and 0 kb downstream of the gene).
| Color | Explain | Details |
|---|---|---|
| red | High impact variants defined by snpEff | 'STOP_LOST', 'START_LOST', 'STOP_GAINED', 'FRAME_SHIFT' et. al., the details can be found at http://snpef f.sourceforge.net/SnpEff_manual.html#eff. |
| purple | 'Damaging' or 'probably damaging' non-synonymous SNPs defined by PolyPhen-2 | This is a qualitative result of nonsynonymous SNP annotation, where 'damaging' or 'probably damaging' means that the variant is more likely to affect protein function. Details can be found here. |
| Var ID | Chrom | Position | Primary Allele | Secondary Allele | Primary Allele Frequency | DEL Frequency | Var | GWAS Results | Effect |
|---|---|---|---|---|---|---|---|---|---|
| vg1126921433 (J) | chr11 | 26921433 | C | CGG | 78.70% | 14.18% | C -> CGG | NA |
LOC_Os11g44510.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os11g44510.1 Alt: CGG| frameshift_variant HIGH(snpEff)/frameshift_variant(CooVar) The average chromatin accessibility score: 69.136; most accessible tissue: Minghui63 root, score: 93.227 |
| vg1126921434 (J) | chr11 | 26921434 | G | T | 49.50% | 14.73% | T -> G,TGGCGCAG CTGGTCGGCG CAGACG |
mr1136 (All); LR P-value: 2.81E-44;
mr1191 (All); LR P-value: 7.20E-10; mr1238 (All); LR P-value: 2.19E-26; mr1309 (All); LR P-value: 5.47E-28; mr1484 (All); LR P-value: 1.45E-19; mr1841 (All); LR P-value: 5.67E-23; mr1900 (All); LR P-value: 4.20E-13; mr1945 (All); LR P-value: 3.55E-10; mr1238_2 (All); LR P-value: 1.21E-27; mr1321_2 (All); LR P-value: 2.22E-07; mr1900_2 (All); LR P-value: 3.39E-20; mr1945_2 (All); LR P-value: 1.96E-18 |
LOC_Os11g44510.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os11g44510.1 Alt: TGGCGCAGCTGGTCGGCGCAGACG| frameshift_variant HIGH(snpEff)/frameshift_variant(CooVar) LOC_Os11g44510.1 Alt: G| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar) The average chromatin accessibility score: 69.136; most accessible tissue: Minghui63 root, score: 93.227 |
| vg1126921462 (J) | chr11 | 26921462 | G | T | 85.40% | 13.67% | G -> T | NA |
LOC_Os11g44510.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/probably damaging(PolyPhen-2)
LOC_Os11g44510.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 70.092; most accessible tissue: Minghui63 root, score: 92.981 |
| vg1126921471 (J) | chr11 | 26921471 | A | ATC | 75.70% | 13.90% | A -> ATC | NA |
LOC_Os11g44510.1 Alt: ATC| frameshift_variant HIGH(snpEff)/frameshift_variant(CooVar)
LOC_Os11g44510.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 69.581; most accessible tissue: Minghui63 root, score: 92.588 |
| vg1126921494 (J) | chr11 | 26921494 | G | A | 84.90% | 13.63% | G -> A | NA |
LOC_Os11g44510.1 Alt: A| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
LOC_Os11g44510.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 69.426; most accessible tissue: Minghui63 root, score: 92.669 |
| vg1126921498 (J) | chr11 | 26921498 | C | A | 75.70% | 13.99% | C -> A | NA |
LOC_Os11g44510.1 Alt: A| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/probably damaging(PolyPhen-2)
LOC_Os11g44510.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 68.689; most accessible tissue: Minghui63 root, score: 92.332 |
| vg1126921536 (J) | chr11 | 26921536 | C | T | 77.00% | 13.80% | C -> T | NA |
LOC_Os11g44510.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
LOC_Os11g44510.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 67.839; most accessible tissue: Minghui63 root, score: 91.553 |
| vg1126921542 (J) | chr11 | 26921542 | T | C | 75.90% | 13.90% | T -> C | NA |
LOC_Os11g44510.1 Alt: DEL/splice_donor_variant(CooVar)
LOC_Os11g44510.1 Alt: C| splice_donor_variant&intron_variant HIGH(snpEff)/splice_donor_variant(CooVar) The average chromatin accessibility score: 67.749; most accessible tissue: Minghui63 root, score: 91.589 |
| vg1126921558 (J) | chr11 | 26921558 | G | A | 85.20% | 13.56% | G -> A | NA |
LOC_Os11g44520.1 Alt: A| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os11g44500.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g44530.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g44510.1 Alt: A| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 66.860; most accessible tissue: Minghui63 root, score: 91.220 |
| vg1126921570 (J) | chr11 | 26921570 | C | T | 75.80% | 13.67% | C -> T | NA |
LOC_Os11g44520.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os11g44500.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g44530.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g44510.1 Alt: T| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 66.475; most accessible tissue: Minghui63 root, score: 91.370 |
| vg1126921638 (J) | chr11 | 26921638 | G | A | 76.10% | 17.05% | G -> A | NA |
LOC_Os11g44510.1 Alt: A| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)
LOC_Os11g44510.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 60.137; most accessible tissue: Minghui63 root, score: 90.815 |
| vg1126921643 (J) | chr11 | 26921643 | G | GGGAGGC GCACGAG CTT | 76.40% | 22.68% | G -> GGGAGGCGCA CGAGCTT | NA |
LOC_Os11g44510.1 Alt: GGGAGGCGCACGAGCTT| frameshift_variant HIGH(snpEff)/frameshift_variant(CooVar)
LOC_Os11g44510.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 58.971; most accessible tissue: Minghui63 root, score: 89.894 |
| vg1126921647 (J) | chr11 | 26921647 | G | A | 76.40% | 22.45% | G -> A,GAGCT | NA |
LOC_Os11g44510.1 Alt: GAGCT| frameshift_variant HIGH(snpEff)/frameshift_variant(CooVar)
LOC_Os11g44510.1 Alt: A| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar) LOC_Os11g44510.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 58.971; most accessible tissue: Minghui63 root, score: 89.944 |
| vg1126921709 (J) | chr11 | 26921709 | T | G | 43.50% | 23.99% | T -> A,G | NA |
LOC_Os11g44510.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os11g44510.1 Alt: A| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar) LOC_Os11g44510.1 Alt: G| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar) The average chromatin accessibility score: 59.564; most accessible tissue: Minghui63 root, score: 88.578 |
| vg1126921730 (J) | chr11 | 26921730 | C | A | 74.80% | 22.64% | C -> A | NA |
LOC_Os11g44510.1 Alt: A| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
LOC_Os11g44510.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 58.696; most accessible tissue: Minghui63 root, score: 88.767 |
| vg1126921769 (J) | chr11 | 26921769 | T | C | 76.70% | 22.28% | T -> C | NA |
LOC_Os11g44510.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os11g44510.1 Alt: C| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar) The average chromatin accessibility score: 59.112; most accessible tissue: Minghui63 root, score: 88.953 |