Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126921638:

Variant ID: vg1126921638 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26921638
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

GCCGTGTGTTCATGATCGCCGAGCTGCTGCCGCACCTGCAGGACCCGGAGGTGATGCGGCGGCCGGAGGTCCGGCGGTCGCTGGCCGGGCTCGGCGACAC[G/A]
CTCCGGCGGTGACTAAGTACAAACTGCTAGATGTGAACACTCGCACCTCCCCTGCTGCTCTTATGGATCTTGCGGCGGCATGCGATCTGGGCGAACGTGA

Reverse complement sequence

TCACGTTCGCCCAGATCGCATGCCGCCGCAAGATCCATAAGAGCAGCAGGGGAGGTGCGAGTGTTCACATCTAGCAGTTTGTACTTAGTCACCGCCGGAG[C/T]
GTGTCGCCGAGCCCGGCCAGCGACCGCCGGACCTCCGGCCGCCGCATCACCTCCGGGTCCTGCAGGTGCGGCAGCAGCTCGGCGATCATGAACACACGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.10%	0.40%	6.45%	17.05%	NA
All Indica	2759	66.70%	0.60%	10.44%	22.29%	NA
All Japonica	1512	90.30%	0.10%	0.73%	8.86%	NA
Aus	269	83.30%	0.00%	0.00%	16.73%	NA
Indica I	595	49.90%	0.50%	13.78%	35.80%	NA
Indica II	465	87.30%	0.00%	7.10%	5.59%	NA
Indica III	913	61.60%	0.90%	10.95%	26.62%	NA
Indica Intermediate	786	73.20%	0.60%	9.29%	16.92%	NA
Temperate Japonica	767	91.10%	0.10%	0.26%	8.47%	NA
Tropical Japonica	504	93.70%	0.00%	0.40%	5.95%	NA
Japonica Intermediate	241	80.90%	0.00%	2.90%	16.18%	NA
VI/Aromatic	96	95.80%	0.00%	3.12%	1.04%	NA
Intermediate	90	84.40%	0.00%	3.33%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126921638	G -> A	LOC_Os11g44510.1	missense_variant ; p.Ala62Thr; MODERATE	nonsynonymous_codon ; A62T	Average:60.137; most accessible tissue: Minghui63 root, score: 90.815	unknown	unknown	DELETERIOUS	0.04
vg1126921638	G -> DEL	LOC_Os11g44510.1	N	frameshift_variant	Average:60.137; most accessible tissue: Minghui63 root, score: 90.815	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1126921638	G	A	-0.05	-0.02	-0.03	-0.01	-0.03	-0.05