Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126921643:

Variant ID: vg1126921643 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 26921643
Reference Allele: GAlternative Allele: GGGAGGCGCACGAGCTT
Primary Allele: GSecondary Allele: GGGAGGCGCACGAGCTT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGTTCATGATCGCCGAGCTGCTGCCGCACCTGCAGGACCCGGAGGTGATGCGGCGGCCGGAGGTCCGGCGGTCGCTGGCCGGGCTCGGCGACACGCTCC[G/GGGAGGCGCACGAGCTT]
GCGGTGACTAAGTACAAACTGCTAGATGTGAACACTCGCACCTCCCCTGCTGCTCTTATGGATCTTGCGGCGGCATGCGATCTGGGCGAACGTGATTTCG

Reverse complement sequence

CGAAATCACGTTCGCCCAGATCGCATGCCGCCGCAAGATCCATAAGAGCAGCAGGGGAGGTGCGAGTGTTCACATCTAGCAGTTTGTACTTAGTCACCGC[C/AAGCTCGTGCGCCTCCC]
GGAGCGTGTCGCCGAGCCCGGCCAGCGACCGCCGGACCTCCGGCCGCCGCATCACCTCCGGGTCCTGCAGGTGCGGCAGCAGCTCGGCGATCATGAACAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of GGGAGGCGCACGAGCTT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.40% 0.10% 0.85% 22.68% NA
All Indica  2759 67.10% 0.10% 1.23% 31.53% NA
All Japonica  1512 90.50% 0.00% 0.20% 9.33% NA
Aus  269 83.30% 0.70% 0.00% 15.99% NA
Indica I  595 50.40% 0.00% 2.18% 47.39% NA
Indica II  465 87.70% 0.00% 0.86% 11.40% NA
Indica III  913 62.20% 0.20% 1.10% 36.47% NA
Indica Intermediate  786 73.30% 0.10% 0.89% 25.70% NA
Temperate Japonica  767 91.30% 0.00% 0.26% 8.47% NA
Tropical Japonica  504 93.70% 0.00% 0.00% 6.35% NA
Japonica Intermediate  241 81.30% 0.00% 0.41% 18.26% NA
VI/Aromatic  96 94.80% 0.00% 3.12% 2.08% NA
Intermediate  90 82.20% 0.00% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126921643 G -> GGGAGGCGCACGAGCTT LOC_Os11g44510.1 frameshift_variant ; p.Ala64fs; HIGH frameshift_variant Average:58.971; most accessible tissue: Minghui63 root, score: 89.894 N N N N
vg1126921643 G -> DEL LOC_Os11g44510.1 N frameshift_variant Average:58.971; most accessible tissue: Minghui63 root, score: 89.894 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126921643 G GGGAG* 0.08 0.04 0.0 -0.05 0.02 0.02