Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126921471:

Variant ID: vg1126921471 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 26921471
Reference Allele: AAlternative Allele: ATC
Primary Allele: ASecondary Allele: ATC

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCTTCCGAGTTCTTTGAGATTGCCACGGCGAGATGTGGAGCGGGATGGGGCAGGCGGCGACTGTGGCGCAGCTGGTCGGCGCAGACGTCGGCAGGCTC[A/ATC]
TCTCCATGATCATGCAGGCGGCGTTGCCGGCTCAGCGGAACAAGAAGGAGTGCGAGCAGCTCGCCCGCCGTGTGTTCATGATCGCCGAGCTGCTGCCGCA

Reverse complement sequence

TGCGGCAGCAGCTCGGCGATCATGAACACACGGCGGGCGAGCTGCTCGCACTCCTTCTTGTTCCGCTGAGCCGGCAACGCCGCCTGCATGATCATGGAGA[T/GAT]
GAGCCTGCCGACGTCTGCGCCGACCAGCTGCGCCACAGTCGCCGCCTGCCCCATCCCGCTCCACATCTCGCCGTGGCAATCTCAAAGAACTCGGAAGAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of ATC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.70% 9.70% 0.66% 13.90% NA
All Indica  2759 66.30% 14.00% 0.80% 18.92% NA
All Japonica  1512 90.10% 2.60% 0.46% 6.81% NA
Aus  269 82.50% 8.90% 0.00% 8.55% NA
Indica I  595 49.10% 17.60% 0.84% 32.44% NA
Indica II  465 86.70% 10.30% 0.22% 2.80% NA
Indica III  913 61.10% 14.00% 1.10% 23.77% NA
Indica Intermediate  786 73.20% 13.50% 0.76% 12.60% NA
Temperate Japonica  767 90.70% 1.00% 0.52% 7.69% NA
Tropical Japonica  504 93.70% 1.40% 0.40% 4.56% NA
Japonica Intermediate  241 80.90% 10.00% 0.41% 8.71% NA
VI/Aromatic  96 93.80% 4.20% 1.04% 1.04% NA
Intermediate  90 84.40% 5.60% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126921471 A -> ATC LOC_Os11g44510.1 frameshift_variant ; p.Met21fs; HIGH frameshift_variant Average:69.581; most accessible tissue: Minghui63 root, score: 92.588 N N N N
vg1126921471 A -> DEL LOC_Os11g44510.1 N frameshift_variant Average:69.581; most accessible tissue: Minghui63 root, score: 92.588 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126921471 A ATC -0.13 -0.04 0.0 -0.05 -0.07 -0.04