\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121939386:

Variant ID: vg1121939386 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21939386
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGGAAGTGTGAGACTAATCACGAAAGACATTGTTAGACCCGTCCATAACCGCGGGCACGGCTATTCGAATAGTTTTACACTGGCCAGAAATGTACCACT[A/G]
TACCCACAAGACACAGCCCCACGACATGTCACCATGCGCCTCAATACCACCACGGTACCTCGGAAAGGAGCTGTGACAGTACCCCTCGCACAACACAATC

Reverse complement sequence

GATTGTGTTGTGCGAGGGGTACTGTCACAGCTCCTTTCCGAGGTACCGTGGTGGTATTGAGGCGCATGGTGACATGTCGTGGGGCTGTGTCTTGTGGGTA[T/C]
AGTGGTACATTTCTGGCCAGTGTAAAACTATTCGAATAGCCGTGCCCGCGGTTATGGACGGGTCTAACAATGTCTTTCGTGATTAGTCTCACACTTCCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.30% 15.30% 9.25% 5.12% NA
All Indica  2759 86.00% 1.20% 8.74% 4.10% NA
All Japonica  1512 44.70% 44.80% 7.94% 2.51% NA
Aus  269 64.70% 1.10% 9.67% 24.54% NA
Indica I  595 78.50% 1.30% 20.00% 0.17% NA
Indica II  465 88.80% 1.10% 9.03% 1.08% NA
Indica III  913 88.90% 0.90% 2.96% 7.23% NA
Indica Intermediate  786 86.50% 1.50% 6.74% 5.22% NA
Temperate Japonica  767 25.60% 68.80% 5.08% 0.52% NA
Tropical Japonica  504 71.00% 10.50% 13.10% 5.36% NA
Japonica Intermediate  241 50.60% 40.20% 6.22% 2.90% NA
VI/Aromatic  96 41.70% 0.00% 39.58% 18.75% NA
Intermediate  90 67.80% 11.10% 13.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121939386 A -> DEL N N silent_mutation Average:21.485; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg1121939386 A -> G LOC_Os11g37160.1 upstream_gene_variant ; 2340.0bp to feature; MODIFIER silent_mutation Average:21.485; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg1121939386 A -> G LOC_Os11g37160-LOC_Os11g37170 intergenic_region ; MODIFIER silent_mutation Average:21.485; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121939386 NA 7.66E-06 mr1263 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 NA 8.11E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 NA 7.66E-06 mr1451 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 NA 7.93E-07 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 6.86E-06 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 2.64E-07 5.31E-11 mr1539 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 NA 3.66E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 NA 5.61E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 6.82E-06 8.73E-21 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 NA 5.50E-06 mr1686 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 NA 1.53E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 NA 5.60E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 NA 5.84E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 NA 4.41E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 NA 9.00E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 NA 1.58E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 5.09E-06 1.60E-17 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 NA 1.04E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 NA 3.07E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 NA 1.42E-21 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121939386 NA 8.30E-08 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251