\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020038760:

Variant ID: vg1020038760 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20038760
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


CTTATGAGAGCAGTTCATGTTGTGGCATCGTCATTACTTTATCATTTCCATGAGAGAAAATTTGTGCTAGTGAATGAGGGTTTACAACGATTTGTCGAGT[A/C]
GGTCCAAATTAAGATTCCAAGGAACTATACCATTGGTCCAAATTCGGTCGTGGAGACAAACATTAATGGTATTGTTATCCAACAGCCAAAGGTAGCAGAA

Reverse complement sequence

TTCTGCTACCTTTGGCTGTTGGATAACAATACCATTAATGTTTGTCTCCACGACCGAATTTGGACCAATGGTATAGTTCCTTGGAATCTTAATTTGGACC[T/G]
ACTCGACAAATCGTTGTAAACCCTCATTCACTAGCACAAATTTTCTCTCATGGAAATGATAAAGTAATGACGATGCCACAACATGAACTGCTCTCATAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.30% 12.30% 0.85% 0.53% NA
All Indica  2759 98.40% 0.60% 0.07% 0.91% NA
All Japonica  1512 60.60% 36.80% 2.51% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 97.40% 0.00% 0.22% 2.41% NA
Indica Intermediate  786 99.20% 0.40% 0.00% 0.38% NA
Temperate Japonica  767 28.70% 68.30% 3.00% 0.00% NA
Tropical Japonica  504 97.80% 1.00% 1.19% 0.00% NA
Japonica Intermediate  241 84.60% 11.60% 3.73% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020038760 A -> C LOC_Os10g37440.1 upstream_gene_variant ; 626.0bp to feature; MODIFIER silent_mutation Average:37.002; most accessible tissue: Callus, score: 77.963 N N N N
vg1020038760 A -> C LOC_Os10g37430.1 downstream_gene_variant ; 1559.0bp to feature; MODIFIER silent_mutation Average:37.002; most accessible tissue: Callus, score: 77.963 N N N N
vg1020038760 A -> C LOC_Os10g37440-LOC_Os10g37450 intergenic_region ; MODIFIER silent_mutation Average:37.002; most accessible tissue: Callus, score: 77.963 N N N N
vg1020038760 A -> DEL N N silent_mutation Average:37.002; most accessible tissue: Callus, score: 77.963 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020038760 NA 3.01E-13 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1020038760 NA 2.03E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1020038760 NA 9.11E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1020038760 NA 9.78E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1020038760 NA 2.79E-16 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1020038760 NA 3.80E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1020038760 NA 3.58E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760 NA 2.69E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760 NA 3.11E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760 NA 1.87E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760 NA 2.25E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760 NA 8.82E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760 NA 9.36E-11 mr1570_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760 NA 4.14E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760 NA 2.09E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760 NA 6.81E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251