Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020038760:

Variant ID: vg1020038760 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 20038760
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

CTTATGAGAGCAGTTCATGTTGTGGCATCGTCATTACTTTATCATTTCCATGAGAGAAAATTTGTGCTAGTGAATGAGGGTTTACAACGATTTGTCGAGT[A/C]
GGTCCAAATTAAGATTCCAAGGAACTATACCATTGGTCCAAATTCGGTCGTGGAGACAAACATTAATGGTATTGTTATCCAACAGCCAAAGGTAGCAGAA

Reverse complement sequence

TTCTGCTACCTTTGGCTGTTGGATAACAATACCATTAATGTTTGTCTCCACGACCGAATTTGGACCAATGGTATAGTTCCTTGGAATCTTAATTTGGACC[T/G]
ACTCGACAAATCGTTGTAAACCCTCATTCACTAGCACAAATTTTCTCTCATGGAAATGATAAAGTAATGACGATGCCACAACATGAACTGCTCTCATAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.30%	12.30%	0.85%	0.53%	NA
All Indica	2759	98.40%	0.60%	0.07%	0.91%	NA
All Japonica	1512	60.60%	36.80%	2.51%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	97.40%	0.00%	0.22%	2.41%	NA
Indica Intermediate	786	99.20%	0.40%	0.00%	0.38%	NA
Temperate Japonica	767	28.70%	68.30%	3.00%	0.00%	NA
Tropical Japonica	504	97.80%	1.00%	1.19%	0.00%	NA
Japonica Intermediate	241	84.60%	11.60%	3.73%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1020038760	A -> C	LOC_Os10g37440.1	upstream_gene_variant ; 626.0bp to feature; MODIFIER	silent_mutation	Average:37.002; most accessible tissue: Callus, score: 77.963	N	N	N	N
vg1020038760	A -> C	LOC_Os10g37430.1	downstream_gene_variant ; 1559.0bp to feature; MODIFIER	silent_mutation	Average:37.002; most accessible tissue: Callus, score: 77.963	N	N	N	N
vg1020038760	A -> C	LOC_Os10g37440-LOC_Os10g37450	intergenic_region ; MODIFIER	silent_mutation	Average:37.002; most accessible tissue: Callus, score: 77.963	N	N	N	N
vg1020038760	A -> DEL	N	N	silent_mutation	Average:37.002; most accessible tissue: Callus, score: 77.963	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1020038760	NA	3.01E-13	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1020038760	NA	2.03E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1020038760	NA	9.11E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1020038760	NA	9.78E-13	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1020038760	NA	2.79E-16	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1020038760	NA	3.80E-12	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1020038760	NA	3.58E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760	NA	2.69E-07	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760	NA	3.11E-08	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760	NA	1.87E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760	NA	2.25E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760	NA	8.82E-08	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760	NA	9.36E-11	mr1570_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760	NA	4.14E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760	NA	2.09E-09	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020038760	NA	6.81E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251