Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000778123:

Variant ID: vg1000778123 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 778123
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTACTATCTCCAAATTAAAATGTAGCTATTTCTAGCATAATATCTTGATCCAAAATAAAACTATTTCTACACCTACCTACTCTCAACCAATCAGAATC[A/G]
TTCTCTTTCATCTATTTTCTCTTTTCAACCAATCACATATATACTCTAATCATTCTCACCAACTTTCTTAATACCCGTGCCCACCTAAAAAATGTTTACA

Reverse complement sequence

TGTAAACATTTTTTAGGTGGGCACGGGTATTAAGAAAGTTGGTGAGAATGATTAGAGTATATATGTGATTGGTTGAAAAGAGAAAATAGATGAAAGAGAA[T/C]
GATTCTGATTGGTTGAGAGTAGGTAGGTGTAGAAATAGTTTTATTTTGGATCAAGATATTATGCTAGAAATAGCTACATTTTAATTTGGAGATAGTAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.80%	13.10%	0.06%	0.00%	NA
All Indica	2759	99.50%	0.40%	0.04%	0.00%	NA
All Japonica	1512	61.00%	39.00%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.60%	0.13%	0.00%	NA
Temperate Japonica	767	33.10%	66.90%	0.00%	0.00%	NA
Tropical Japonica	504	96.20%	3.80%	0.00%	0.00%	NA
Japonica Intermediate	241	75.90%	24.10%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	0.00%	2.08%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000778123	A -> G	LOC_Os10g02220.1	upstream_gene_variant ; 1782.0bp to feature; MODIFIER	silent_mutation	Average:25.961; most accessible tissue: Zhenshan97 root, score: 36.298	N	N	N	N
vg1000778123	A -> G	LOC_Os10g02220.2	upstream_gene_variant ; 1962.0bp to feature; MODIFIER	silent_mutation	Average:25.961; most accessible tissue: Zhenshan97 root, score: 36.298	N	N	N	N
vg1000778123	A -> G	LOC_Os10g02220.3	upstream_gene_variant ; 1887.0bp to feature; MODIFIER	silent_mutation	Average:25.961; most accessible tissue: Zhenshan97 root, score: 36.298	N	N	N	N
vg1000778123	A -> G	LOC_Os10g02220.4	upstream_gene_variant ; 1887.0bp to feature; MODIFIER	silent_mutation	Average:25.961; most accessible tissue: Zhenshan97 root, score: 36.298	N	N	N	N
vg1000778123	A -> G	LOC_Os10g02220.5	upstream_gene_variant ; 1776.0bp to feature; MODIFIER	silent_mutation	Average:25.961; most accessible tissue: Zhenshan97 root, score: 36.298	N	N	N	N
vg1000778123	A -> G	LOC_Os10g02230.1	downstream_gene_variant ; 4181.0bp to feature; MODIFIER	silent_mutation	Average:25.961; most accessible tissue: Zhenshan97 root, score: 36.298	N	N	N	N
vg1000778123	A -> G	LOC_Os10g02220-LOC_Os10g02230	intergenic_region ; MODIFIER	silent_mutation	Average:25.961; most accessible tissue: Zhenshan97 root, score: 36.298	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000778123	NA	3.33E-13	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000778123	3.41E-06	2.92E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000778123	NA	3.17E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000778123	NA	7.43E-06	mr1003	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	6.85E-08	mr1010	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	2.23E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	9.23E-11	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	1.76E-07	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	1.26E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	2.80E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	1.61E-36	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	2.77E-12	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	7.77E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	3.09E-07	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	1.56E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	7.52E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	1.80E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	1.61E-10	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	3.21E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	1.36E-07	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	8.92E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	1.01E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	5.04E-31	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	3.64E-10	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000778123	NA	1.36E-16	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251