\
| Variant ID: vg0905150436 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 5150436 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 232. )
AGGAACACATGGATGAATTCTCTATGGGATCCATTGGTTGAGGGAAGTGTGCCCTAGACCTCTTCCCCTAACTGTGGTTCCTCTAGCATTTCCTCTTCCC[T/C]
TGACTATAGTTCCTCTAGCATTTCCTCTTCCCCTGACTATAGTTTCTCTAGCATTTTCTCTTCCCCTGTCTGTAGTTCCTCTAGCATTTTCCTTCATGGT
ACCATGAAGGAAAATGCTAGAGGAACTACAGACAGGGGAAGAGAAAATGCTAGAGAAACTATAGTCAGGGGAAGAGGAAATGCTAGAGGAACTATAGTCA[A/G]
GGGAAGAGGAAATGCTAGAGGAACCACAGTTAGGGGAAGAGGTCTAGGGCACACTTCCCTCAACCAATGGATCCCATAGAGAATTCATCCATGTGTTCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.70% | 36.50% | 0.08% | 0.72% | NA |
| All Indica | 2759 | 93.80% | 4.90% | 0.07% | 1.23% | NA |
| All Japonica | 1512 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.90% | 8.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 90.30% | 3.00% | 0.00% | 6.67% | NA |
| Indica III | 913 | 97.50% | 2.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.90% | 5.70% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 6.60% | 93.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 44.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0905150436 | T -> DEL | N | N | silent_mutation | Average:46.768; most accessible tissue: Zhenshan97 young leaf, score: 59.009 | N | N | N | N |
| vg0905150436 | T -> C | LOC_Os09g09540.1 | 3_prime_UTR_variant ; 1275.0bp to feature; MODIFIER | silent_mutation | Average:46.768; most accessible tissue: Zhenshan97 young leaf, score: 59.009 | N | N | N | N |
| vg0905150436 | T -> C | LOC_Os09g09530.1 | upstream_gene_variant ; 4997.0bp to feature; MODIFIER | silent_mutation | Average:46.768; most accessible tissue: Zhenshan97 young leaf, score: 59.009 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0905150436 | NA | 2.55E-22 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905150436 | NA | 7.45E-16 | mr1010 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905150436 | NA | 3.33E-22 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905150436 | NA | 1.41E-43 | mr1141 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905150436 | NA | 3.19E-25 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905150436 | NA | 1.20E-22 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905150436 | NA | 6.78E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905150436 | NA | 1.05E-20 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905150436 | NA | 3.36E-12 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905150436 | NA | 1.18E-31 | mr1913_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |