Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0905150436:

Variant ID: vg0905150436 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 5150436
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

AGGAACACATGGATGAATTCTCTATGGGATCCATTGGTTGAGGGAAGTGTGCCCTAGACCTCTTCCCCTAACTGTGGTTCCTCTAGCATTTCCTCTTCCC[T/C]
TGACTATAGTTCCTCTAGCATTTCCTCTTCCCCTGACTATAGTTTCTCTAGCATTTTCTCTTCCCCTGTCTGTAGTTCCTCTAGCATTTTCCTTCATGGT

Reverse complement sequence

ACCATGAAGGAAAATGCTAGAGGAACTACAGACAGGGGAAGAGAAAATGCTAGAGAAACTATAGTCAGGGGAAGAGGAAATGCTAGAGGAACTATAGTCA[A/G]
GGGAAGAGGAAATGCTAGAGGAACCACAGTTAGGGGAAGAGGTCTAGGGCACACTTCCCTCAACCAATGGATCCCATAGAGAATTCATCCATGTGTTCCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	36.50%	0.08%	0.72%	NA
All Indica	2759	93.80%	4.90%	0.07%	1.23%	NA
All Japonica	1512	2.10%	97.90%	0.00%	0.00%	NA
Aus	269	78.80%	21.20%	0.00%	0.00%	NA
Indica I	595	90.90%	8.90%	0.17%	0.00%	NA
Indica II	465	90.30%	3.00%	0.00%	6.67%	NA
Indica III	913	97.50%	2.40%	0.11%	0.00%	NA
Indica Intermediate	786	93.90%	5.70%	0.00%	0.38%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	1.60%	98.40%	0.00%	0.00%	NA
Japonica Intermediate	241	6.60%	93.40%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	53.30%	44.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0905150436	T -> DEL	N	N	silent_mutation	Average:46.768; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N
vg0905150436	T -> C	LOC_Os09g09540.1	3_prime_UTR_variant ; 1275.0bp to feature; MODIFIER	silent_mutation	Average:46.768; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N
vg0905150436	T -> C	LOC_Os09g09530.1	upstream_gene_variant ; 4997.0bp to feature; MODIFIER	silent_mutation	Average:46.768; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0905150436	NA	2.55E-22	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436	NA	7.45E-16	mr1010	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436	NA	3.33E-22	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436	NA	1.41E-43	mr1141	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436	NA	3.19E-25	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436	NA	1.20E-22	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436	NA	6.78E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436	NA	1.05E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436	NA	3.36E-12	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436	NA	1.18E-31	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251