\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905150436:

Variant ID: vg0905150436 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 5150436
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


AGGAACACATGGATGAATTCTCTATGGGATCCATTGGTTGAGGGAAGTGTGCCCTAGACCTCTTCCCCTAACTGTGGTTCCTCTAGCATTTCCTCTTCCC[T/C]
TGACTATAGTTCCTCTAGCATTTCCTCTTCCCCTGACTATAGTTTCTCTAGCATTTTCTCTTCCCCTGTCTGTAGTTCCTCTAGCATTTTCCTTCATGGT

Reverse complement sequence

ACCATGAAGGAAAATGCTAGAGGAACTACAGACAGGGGAAGAGAAAATGCTAGAGAAACTATAGTCAGGGGAAGAGGAAATGCTAGAGGAACTATAGTCA[A/G]
GGGAAGAGGAAATGCTAGAGGAACCACAGTTAGGGGAAGAGGTCTAGGGCACACTTCCCTCAACCAATGGATCCCATAGAGAATTCATCCATGTGTTCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 36.50% 0.08% 0.72% NA
All Indica  2759 93.80% 4.90% 0.07% 1.23% NA
All Japonica  1512 2.10% 97.90% 0.00% 0.00% NA
Aus  269 78.80% 21.20% 0.00% 0.00% NA
Indica I  595 90.90% 8.90% 0.17% 0.00% NA
Indica II  465 90.30% 3.00% 0.00% 6.67% NA
Indica III  913 97.50% 2.40% 0.11% 0.00% NA
Indica Intermediate  786 93.90% 5.70% 0.00% 0.38% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 6.60% 93.40% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 53.30% 44.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0905150436 T -> DEL N N silent_mutation Average:46.768; most accessible tissue: Zhenshan97 young leaf, score: 59.009 N N N N
vg0905150436 T -> C LOC_Os09g09540.1 3_prime_UTR_variant ; 1275.0bp to feature; MODIFIER silent_mutation Average:46.768; most accessible tissue: Zhenshan97 young leaf, score: 59.009 N N N N
vg0905150436 T -> C LOC_Os09g09530.1 upstream_gene_variant ; 4997.0bp to feature; MODIFIER silent_mutation Average:46.768; most accessible tissue: Zhenshan97 young leaf, score: 59.009 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0905150436 NA 2.55E-22 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436 NA 7.45E-16 mr1010 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436 NA 3.33E-22 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436 NA 1.41E-43 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436 NA 3.19E-25 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436 NA 1.20E-22 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436 NA 6.78E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436 NA 1.05E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436 NA 3.36E-12 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150436 NA 1.18E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251