\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724243419:

Variant ID: vg0724243419 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 24243419
Reference Allele: GAlternative Allele: A,GTTTCCACCTCCACAGCTCAACCAAAACTGGATGA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTTTACATTTAGTCGCGACTAAAATCTTTTTTTTAAGCGTGTTTTCTCGATATCGATATTTTGAGTCTGTTTGACACAGCTCTAGCTCCACCCCTTCTG[G/A,GTTTCCACCTCCACAGCTCAACCAAAACTGGATGA]
AGTTTCCACCTCCACAGCTCAACCAAAACTGGATGGAAGTGGAGCTGGGTAGAGGAAGTGGACCCTGGATGAACTGGATGGAAGTGGACCCTGGGGTACC

Reverse complement sequence

GGTACCCCAGGGTCCACTTCCATCCAGTTCATCCAGGGTCCACTTCCTCTACCCAGCTCCACTTCCATCCAGTTTTGGTTGAGCTGTGGAGGTGGAAACT[C/T,TCATCCAGTTTTGGTTGAGCTGTGGAGGTGGAAAC]
CAGAAGGGGTGGAGCTAGAGCTGTGTCAAACAGACTCAAAATATCGATATCGAGAAAACACGCTTAAAAAAAAGATTTTAGTCGCGACTAAATGTAAACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 24.80% 2.35% 13.12% GTTTCCACCTCCACAGCTCAACCAAAACTGGATGA: 0.02%
All Indica  2759 71.90% 3.90% 2.17% 22.04% NA
All Japonica  1512 44.20% 54.70% 0.86% 0.13% GTTTCCACCTCCACAGCTCAACCAAAACTGGATGA: 0.07%
Aus  269 24.90% 66.90% 7.81% 0.37% NA
Indica I  595 92.10% 0.70% 3.36% 3.87% NA
Indica II  465 69.00% 8.40% 0.86% 21.72% NA
Indica III  913 62.10% 2.60% 0.22% 35.05% NA
Indica Intermediate  786 69.60% 5.20% 4.33% 20.87% NA
Temperate Japonica  767 81.10% 18.40% 0.52% 0.00% NA
Tropical Japonica  504 1.40% 97.20% 0.79% 0.40% GTTTCCACCTCCACAGCTCAACCAAAACTGGATGA: 0.20%
Japonica Intermediate  241 16.60% 81.30% 2.07% 0.00% NA
VI/Aromatic  96 60.40% 32.30% 5.21% 2.08% NA
Intermediate  90 51.10% 27.80% 13.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724243419 G -> DEL N N silent_mutation Average:96.326; most accessible tissue: Zhenshan97 flower, score: 98.632 N N N N
vg0724243419 G -> GTTTCCACCTCCACAGCTCAACCAAAACTG GATGA LOC_Os07g40434.1 upstream_gene_variant ; 4229.0bp to feature; MODIFIER silent_mutation Average:96.326; most accessible tissue: Zhenshan97 flower, score: 98.632 N N N N
vg0724243419 G -> GTTTCCACCTCCACAGCTCAACCAAAACTG GATGA LOC_Os07g40450.1 upstream_gene_variant ; 51.0bp to feature; MODIFIER silent_mutation Average:96.326; most accessible tissue: Zhenshan97 flower, score: 98.632 N N N N
vg0724243419 G -> GTTTCCACCTCCACAGCTCAACCAAAACTG GATGA LOC_Os07g40460.1 upstream_gene_variant ; 526.0bp to feature; MODIFIER silent_mutation Average:96.326; most accessible tissue: Zhenshan97 flower, score: 98.632 N N N N
vg0724243419 G -> GTTTCCACCTCCACAGCTCAACCAAAACTG GATGA LOC_Os07g40450.2 upstream_gene_variant ; 51.0bp to feature; MODIFIER silent_mutation Average:96.326; most accessible tissue: Zhenshan97 flower, score: 98.632 N N N N
vg0724243419 G -> GTTTCCACCTCCACAGCTCAACCAAAACTG GATGA LOC_Os07g40460.2 upstream_gene_variant ; 681.0bp to feature; MODIFIER silent_mutation Average:96.326; most accessible tissue: Zhenshan97 flower, score: 98.632 N N N N
vg0724243419 G -> GTTTCCACCTCCACAGCTCAACCAAAACTG GATGA LOC_Os07g40460.3 upstream_gene_variant ; 681.0bp to feature; MODIFIER silent_mutation Average:96.326; most accessible tissue: Zhenshan97 flower, score: 98.632 N N N N
vg0724243419 G -> GTTTCCACCTCCACAGCTCAACCAAAACTG GATGA LOC_Os07g40450-LOC_Os07g40460 intergenic_region ; MODIFIER silent_mutation Average:96.326; most accessible tissue: Zhenshan97 flower, score: 98.632 N N N N
vg0724243419 G -> A LOC_Os07g40434.1 upstream_gene_variant ; 4228.0bp to feature; MODIFIER silent_mutation Average:96.326; most accessible tissue: Zhenshan97 flower, score: 98.632 N N N N
vg0724243419 G -> A LOC_Os07g40450.1 upstream_gene_variant ; 50.0bp to feature; MODIFIER silent_mutation Average:96.326; most accessible tissue: Zhenshan97 flower, score: 98.632 N N N N
vg0724243419 G -> A LOC_Os07g40460.1 upstream_gene_variant ; 527.0bp to feature; MODIFIER silent_mutation Average:96.326; most accessible tissue: Zhenshan97 flower, score: 98.632 N N N N
vg0724243419 G -> A LOC_Os07g40450.2 upstream_gene_variant ; 50.0bp to feature; MODIFIER silent_mutation Average:96.326; most accessible tissue: Zhenshan97 flower, score: 98.632 N N N N
vg0724243419 G -> A LOC_Os07g40460.2 upstream_gene_variant ; 682.0bp to feature; MODIFIER silent_mutation Average:96.326; most accessible tissue: Zhenshan97 flower, score: 98.632 N N N N
vg0724243419 G -> A LOC_Os07g40460.3 upstream_gene_variant ; 682.0bp to feature; MODIFIER silent_mutation Average:96.326; most accessible tissue: Zhenshan97 flower, score: 98.632 N N N N
vg0724243419 G -> A LOC_Os07g40450-LOC_Os07g40460 intergenic_region ; MODIFIER silent_mutation Average:96.326; most accessible tissue: Zhenshan97 flower, score: 98.632 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0724243419 G A 0.01 0.03 0.02 -0.02 0.0 0.0
vg0724243419 G GTTTC* -0.05 -0.08 -0.07 -0.1 -0.1 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724243419 NA 2.22E-14 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724243419 NA 3.03E-13 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 NA 5.07E-09 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 NA 2.24E-11 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 NA 3.09E-08 mr1282 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 NA 1.01E-11 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 NA 9.32E-07 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 NA 6.00E-10 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 NA 3.04E-07 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 9.00E-06 9.00E-06 mr1853 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 NA 1.92E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 NA 4.55E-15 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 NA 3.93E-10 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 NA 2.06E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 NA 1.38E-07 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 NA 7.76E-14 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 NA 9.39E-07 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 NA 2.69E-16 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724243419 NA 6.98E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251