\
| Variant ID: vg0423583513 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 23583513 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, T: 0.19, others allele: 0.00, population size: 209. )
GGCTTAACAACACTGAGAAAATGACAGTAAAAAAGAAGAATTCAGTTTCAGAGCTGATCCTTGTTCTTCACGAGGATTTCACAACAAAAGTGTTGTTTTT[A/T]
AAAAAAATAAAACAGAGCCACCTTTTTTCGAAACAGAAGAAGGCCACAGGTTCCAGCAAAAAAAAAGAACTCCAAATTTCAATTTTGTTCGCCTCTGAAC
GTTCAGAGGCGAACAAAATTGAAATTTGGAGTTCTTTTTTTTTGCTGGAACCTGTGGCCTTCTTCTGTTTCGAAAAAAGGTGGCTCTGTTTTATTTTTTT[T/A]
AAAAACAACACTTTTGTTGTGAAATCCTCGTGAAGAACAAGGATCAGCTCTGAAACTGAATTCTTCTTTTTTACTGTCATTTTCTCAGTGTTGTTAAGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.00% | 38.90% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 34.30% | 65.60% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 8.00% | 91.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 20.50% | 79.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 26.10% | 73.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0423583513 | A -> T | LOC_Os04g39570.2 | upstream_gene_variant ; 193.0bp to feature; MODIFIER | silent_mutation | Average:62.082; most accessible tissue: Callus, score: 93.738 | N | N | N | N |
| vg0423583513 | A -> T | LOC_Os04g39570.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.082; most accessible tissue: Callus, score: 93.738 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0423583513 | NA | 7.09E-16 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0423583513 | NA | 1.19E-14 | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0423583513 | NA | 1.27E-09 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0423583513 | NA | 1.61E-17 | Heading_date | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0423583513 | NA | 1.98E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 2.38E-07 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 3.26E-06 | mr1057 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 2.69E-06 | mr1136 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 1.00E-06 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 2.23E-07 | mr1399 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 9.24E-08 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 8.67E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 7.53E-06 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 1.15E-10 | mr1608 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 1.38E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 1.31E-08 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 6.36E-06 | mr1656 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 8.02E-07 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 2.01E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 2.50E-10 | mr1794 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 1.53E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 8.73E-11 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 8.35E-06 | mr1876 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 3.31E-07 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 2.70E-06 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423583513 | NA | 1.22E-07 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |