236 variations found. Os01g0358700/LOC_Os01g25630 (NB-ARC domain containing protein; expressed), ranging from 14,526,601 bp to 14,531,604 bp (including 0 kb upstream and 0 kb downstream of the gene).
| Gene ID | Annotation |
|---|---|
| LOC_Os01g25630 | NB-ARC domain containing protein, expressed; RAP ID: Os01g0358700; MSU ID: LOC_Os01g25630 |
The expression data is from the CREP database. And the expression value is log2-transformed. Move the mouse over the cells of the heat map to get detailed tissue information and expression values.
| Color | Explain | Details |
|---|---|---|
| red | High impact variants defined by snpEff | 'STOP_LOST', 'START_LOST', 'STOP_GAINED', 'FRAME_SHIFT' et. al., the details can be found at http://snpef f.sourceforge.net/SnpEff_manual.html#eff. |
| purple | 'Damaging' or 'probably damaging' non-synonymous SNPs defined by PolyPhen-2 | This is a qualitative result of nonsynonymous SNP annotation, where 'damaging' or 'probably damaging' means that the variant is more likely to affect protein function. Details can be found here. |
| Var ID | Chrom | Position | Primary Allele | Secondary Allele | Primary Allele Frequency | DEL Frequency | Var | GWAS Results | Effect |
|---|---|---|---|---|---|---|---|---|---|
| STR0114526975 (J) | chr01 | 14526975 | GA | GG | 88.20% | 0.00% | GA -> GG | NA |
|
| STR0114527424 (J) | chr01 | 14527424 | AGAGAGA G | AGAGAG | 95.10% | 0.00% | AGAGAGAG -> AGAGAG | NA |
|
| STR0114530112 (J) | chr01 | 14530112 | TT | TTT | 66.40% | 0.00% | TTT -> TT | NA |
|
| vg0114526611 (J) | chr01 | 14526611 | G | A | 95.10% | 4.21% | G -> A | NA |
LOC_Os01g25630.1 Alt: A| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
LOC_Os01g25630.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 41.890; most accessible tissue: Zhenshan97 flower, score: 74.205 |
| vg0114526623 (J) | chr01 | 14526623 | T | A | 80.30% | 4.25% | T -> A | NA |
LOC_Os01g25630.1 Alt: A| synonymous_variant LOW(snpEff)/nonsynonymous_codon(CooVar)
LOC_Os01g25630.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 42.821; most accessible tissue: Zhenshan97 flower, score: 75.194 |
| vg0114526624 (J) | chr01 | 14526624 | A | C | 79.60% | 4.89% | A -> C | NA |
LOC_Os01g25630.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os01g25630.1 Alt: C| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar) The average chromatin accessibility score: 43.334; most accessible tissue: Zhenshan97 flower, score: 75.194 |
| vg0114526630 (J) | chr01 | 14526630 | G | A | 95.00% | 4.13% | G -> A | NA |
LOC_Os01g25630.1 Alt: A| splice_region_variant&intron_variant LOW(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 43.417; most accessible tissue: Zhenshan97 flower, score: 75.194 |
| vg0114526634 (J) | chr01 | 14526634 | A | G | 83.20% | 4.17% | A -> G |
LOC_Os01g25630.1 Alt: G| splice_region_variant&intron_variant LOW(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 43.302; most accessible tissue: Zhenshan97 flower, score: 74.953 |
|
| vg0114526638 (J) | chr01 | 14526638 | G | A | 94.70% | 3.77% | G -> A | NA |
LOC_Os01g25630.1 Alt: A| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 43.302; most accessible tissue: Zhenshan97 flower, score: 74.953 |
| vg0114526665 (J) | chr01 | 14526665 | A | G | 95.00% | 4.25% | A -> G | NA |
LOC_Os01g25630.1 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 44.900; most accessible tissue: Zhenshan97 flower, score: 75.194 |
| vg0114526710 (J) | chr01 | 14526710 | TGAA | T | 94.90% | 4.23% | TGAA -> T | NA |
LOC_Os01g25630.1 Alt: T| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 48.984; most accessible tissue: Zhenshan97 flower, score: 76.539 |
| vg0114526716 (J) | chr01 | 14526716 | C | T | 61.90% | 4.40% | T -> C | NA |
N Alt: DEL/silent_mutation(CooVar)
LOC_Os01g25630.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 49.290; most accessible tissue: Zhenshan97 flower, score: 76.539 |
| vg0114526720 (J) | chr01 | 14526720 | C | A | 84.60% | 3.89% | C -> A | NA |
LOC_Os01g25630.1 Alt: A| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 50.113; most accessible tissue: Zhenshan97 flower, score: 77.366 |
| vg0114526743 (J) | chr01 | 14526743 | T | C | 95.00% | 3.94% | T -> C | NA |
N Alt: DEL/silent_mutation(CooVar)
LOC_Os01g25630.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 50.682; most accessible tissue: Zhenshan97 flower, score: 78.853 |
| vg0114526754 (J) | chr01 | 14526754 | C | G | 95.00% | 3.91% | C -> G | NA |
LOC_Os01g25630.1 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 51.738; most accessible tissue: Zhenshan97 flower, score: 78.853 |
| vg0114526761 (J) | chr01 | 14526761 | GC | AC | 89.90% | 4.25% | GC -> AC,G |
LOC_Os01g25630.1 Alt: G| intron_variant MODIFIER(snpEff)
LOC_Os01g25630.1 Alt: AC| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 51.950; most accessible tissue: Zhenshan97 flower, score: 79.691 |
|
| vg0114526813 (J) | chr01 | 14526813 | G | A | 95.00% | 3.85% | G -> A | NA |
LOC_Os01g25630.1 Alt: A| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 51.344; most accessible tissue: Zhenshan97 flower, score: 78.853 |
| vg0114526818 (J) | chr01 | 14526818 | G | GTCGAAA CTAGATT TCGGCA | 95.50% | 3.64% | G -> GTCGAAACTA GATTTCGGCA ,GTCGAAACT AGATTTCGGC | NA |
LOC_Os01g25630.1 Alt: GTCGAAACTAGATTTCGGCA| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os01g25630.1 Alt: GTCGAAACTAGATTTCGGC| intron_variant MODIFIER(snpEff) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 51.182; most accessible tissue: Zhenshan97 flower, score: 78.853 |
| vg0114526827 (J) | chr01 | 14526827 | T | A | 91.70% | 4.13% | T -> A |
LOC_Os01g25630.1 Alt: A| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 48.895; most accessible tissue: Zhenshan97 flower, score: 77.563 |
|
| vg0114526835 (J) | chr01 | 14526835 | GT | G | 95.00% | 4.04% | GT -> G | NA |
LOC_Os01g25630.1 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 49.312; most accessible tissue: Zhenshan97 flower, score: 77.755 |
| vg0114526919 (J) | chr01 | 14526919 | T | C | 95.50% | 3.60% | T -> C | NA |
N Alt: DEL/silent_mutation(CooVar)
LOC_Os01g25630.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 45.916; most accessible tissue: Zhenshan97 flower, score: 73.683 |
| vg0114526976 (J) | chr01 | 14526976 | A | G | 83.30% | 3.94% | A -> G |
|
LOC_Os01g25630.1 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 46.758; most accessible tissue: Callus, score: 80.000 |
| vg0114526997 (J) | chr01 | 14526997 | C | T | 81.70% | 3.87% | C -> T |
LOC_Os01g25630.1 Alt: T| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 48.022; most accessible tissue: Callus, score: 80.000 |
|
| vg0114527001 (J) | chr01 | 14527001 | TA | T | 95.60% | 3.34% | TA -> T | NA |
LOC_Os01g25630.1 Alt: T| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 48.227; most accessible tissue: Callus, score: 80.000 |
| vg0114527004 (J) | chr01 | 14527004 | G | T | 91.90% | 3.34% | G -> T |
LOC_Os01g25630.1 Alt: T| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 49.075; most accessible tissue: Callus, score: 80.000 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/