16 variations found. LOC_Os08g41120 (MBTB29 - Bric-a-Brac; Tramtrack; Broad Complex BTB domain with Meprin and TRAF Homology MATH domain; expressed), ranging from 25,984,253 bp to 25,985,279 bp (including 0 kb upstream and 0 kb downstream of the gene).
| Color | Explain | Details |
|---|---|---|
| red | High impact variants defined by snpEff | 'STOP_LOST', 'START_LOST', 'STOP_GAINED', 'FRAME_SHIFT' et. al., the details can be found at http://snpef f.sourceforge.net/SnpEff_manual.html#eff. |
| purple | 'Damaging' or 'probably damaging' non-synonymous SNPs defined by PolyPhen-2 | This is a qualitative result of nonsynonymous SNP annotation, where 'damaging' or 'probably damaging' means that the variant is more likely to affect protein function. Details can be found here. |
| Var ID | Chrom | Position | Primary Allele | Secondary Allele | Primary Allele Frequency | DEL Frequency | Var | GWAS Results | Effect |
|---|---|---|---|---|---|---|---|---|---|
| vg0825984270 (J) | chr08 | 25984270 | C | T | 63.80% | 0.28% | T -> C |
LOC_Os08g41120.1 Alt: C| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)
LOC_Os08g41120.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 86.350; most accessible tissue: Zhenshan97 young leaf, score: 91.151 |
|
| vg0825984301 (J) | chr08 | 25984301 | T | C | 58.10% | 0.15% | C -> T |
mr1037 (All); LR P-value: 1.61E-26;
mr1109 (All); LR P-value: 7.26E-47; mr1139 (All); LR P-value: 1.40E-39; mr1246 (All); LR P-value: 2.32E-61; mr1255 (All); LR P-value: 1.33E-17; mr1299 (All); LR P-value: 2.09E-09; mr1591 (All); LR P-value: 1.68E-43; mr1655 (All); LR P-value: 2.45E-13; mr1657 (All); LR P-value: 2.85E-11; mr1663 (All); LR P-value: 1.94E-09; mr1721 (All); LR P-value: 3.20E-43; mr1756 (All); LR P-value: 1.07E-06; mr1798 (All); LR P-value: 5.84E-50; mr1828 (All); LR P-value: 2.24E-35; mr1862 (All); LR P-value: 1.63E-23; mr1913 (All); LR P-value: 4.14E-17; mr1037_2 (All); LR P-value: 3.72E-32; mr1164_2 (All); LR P-value: 5.91E-21; mr1943_2 (All); LR P-value: 3.76E-25 |
LOC_Os08g41120.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)
LOC_Os08g41120.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 87.554; most accessible tissue: Zhenshan97 young leaf, score: 92.818 |
| vg0825984311 (J) | chr08 | 25984311 | A | T | 99.70% | 0.00% | A -> T | NA |
LOC_Os08g41120.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)
The average chromatin accessibility score: 87.725; most accessible tissue: Zhenshan97 young leaf, score: 92.871 |
| vg0825984334 (J) | chr08 | 25984334 | C | T | 99.70% | 0.00% | C -> T | NA |
LOC_Os08g41120.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)
The average chromatin accessibility score: 83.807; most accessible tissue: Minghui63 young leaf, score: 92.277 |
| vg0825984536 (J) | chr08 | 25984536 | G | GGTC | 94.40% | 0.00% | G -> GGTC | NA |
LOC_Os08g41120.1 Alt: GGTC| disruptive_inframe_insertion MODERATE(snpEff)/inframe_variant(CooVar)
The average chromatin accessibility score: 86.819; most accessible tissue: Zhenshan97 young leaf, score: 93.550 |
| vg0825984544 (J) | chr08 | 25984544 | T | TCGACGA CGA | 56.60% | 0.15% | TCGACGACGA -> T,TCGA,TCG ACGA | NA |
LOC_Os08g41120.1 Alt: TCGA| inframe_deletion MODERATE(snpEff)/inframe_variant(CooVar)
LOC_Os08g41120.1 Alt: T| inframe_deletion MODERATE(snpEff)/inframe_variant(CooVar) LOC_Os08g41120.1 Alt: TCGACGA| inframe_deletion MODERATE(snpEff)/inframe_variant(CooVar) LOC_Os08g41120.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 86.731; most accessible tissue: Zhenshan97 young leaf, score: 93.416 |
| vg0825984547 (J) | chr08 | 25984547 | A | T | 93.80% | 0.00% | A -> T |
mr1028 (All); LR P-value: 1.72E-06;
mr1126 (All); LR P-value: 5.18E-07; mr1207 (All); LR P-value: 3.80E-06; mr1262 (All); LR P-value: 3.89E-08; mr1348 (All); LR P-value: 3.92E-08; mr1365 (All); LR P-value: 1.96E-06; mr1415 (All); LR P-value: 1.04E-06; mr1417 (All); LR P-value: 7.71E-06; mr1453 (All); LR P-value: 2.69E-07; mr1523 (All); LR P-value: 5.26E-06; mr1567 (All); LR P-value: 1.04E-06 |
LOC_Os08g41120.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)
The average chromatin accessibility score: 86.662; most accessible tissue: Zhenshan97 young leaf, score: 93.371 |
| vg0825984550 (J) | chr08 | 25984550 | A | T | 99.70% | 0.00% | A -> T | NA |
LOC_Os08g41120.1 Alt: T| missense_variant MODERATE(snpEff)
LOC_Os08g41130.1 Alt: T| upstream_gene_variant MODIFIER(snpEff) LOC_Os08g41110.1 Alt: T| downstream_gene_variant MODIFIER(snpEff) The average chromatin accessibility score: 86.660; most accessible tissue: Zhenshan97 young leaf, score: 93.371 |
| vg0825984554 (J) | chr08 | 25984554 | C | T | 44.30% | 55.50% | C -> T | NA |
LOC_Os08g41120.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
LOC_Os08g41120.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 86.688; most accessible tissue: Zhenshan97 young leaf, score: 93.550 |
| vg0825984563 (J) | chr08 | 25984563 | T | C | 64.50% | 0.17% | C -> T,CGAT |
LOC_Os08g41120.1 Alt: CGAT| disruptive_inframe_insertion MODERATE(snpEff)/inframe_variant(CooVar)
LOC_Os08g41120.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar) LOC_Os08g41120.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 86.682; most accessible tissue: Zhenshan97 young leaf, score: 93.506 |
|
| vg0825984609 (J) | chr08 | 25984609 | AC | GC | 58.10% | 0.00% | GC -> AC,G |
mr1037 (All); LR P-value: 1.17E-27;
mr1109 (All); LR P-value: 1.66E-47; mr1139 (All); LR P-value: 8.18E-40; mr1246 (All); LR P-value: 8.57E-63; mr1299 (All); LR P-value: 1.93E-09; mr1591 (All); LR P-value: 1.55E-42; mr1655 (All); LR P-value: 2.61E-13; mr1657 (All); LR P-value: 4.21E-11; mr1663 (All); LR P-value: 3.62E-09; mr1721 (All); LR P-value: 2.77E-42; mr1756 (All); LR P-value: 7.84E-07; mr1798 (All); LR P-value: 9.27E-50; mr1828 (All); LR P-value: 5.44E-35; mr1037_2 (All); LR P-value: 4.11E-33; mr1109_2 (All); LR P-value: 6.43E-55; mr1943_2 (All); LR P-value: 3.75E-25 |
LOC_Os08g41120.1 Alt: G| frameshift_variant HIGH(snpEff)/frameshift_variant(CooVar)
LOC_Os08g41120.1 Alt: AC| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/benign(PolyPhen-2) The average chromatin accessibility score: 83.572; most accessible tissue: Zhenshan97 young leaf, score: 93.506 |
| vg0825984731 (J) | chr08 | 25984731 | G | A | 99.70% | 0.00% | G -> A | NA |
LOC_Os08g41120.1 Alt: A| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 84.625; most accessible tissue: Zhenshan97 young leaf, score: 92.924 |
| vg0825985193 (J) | chr08 | 25985193 | CCCGTCG CCGACGC GCTTGTC GAAG | C | 61.90% | 0.00% | C -> CCCGTCGCCG ACGCGCTTGT CGAAG,CCCG TCGCCAACGC GCTTGTCGAA G,CCCGTCGC CGACGCACTT GTCGAAG | NA |
LOC_Os08g41120.1 Alt: CCCGTCGCCGACGCACTTGTCGAAG| disruptive_inframe_insertion MODERATE(snpEff)/inframe_variant(CooVar)
LOC_Os08g41120.1 Alt: CCCGTCGCCGACGCGCTTGTCGAAG| disruptive_inframe_insertion MODERATE(snpEff)/inframe_variant(CooVar) LOC_Os08g41120.1 Alt: CCCGTCGCCAACGCGCTTGTCGAAG| disruptive_inframe_insertion MODERATE(snpEff)/inframe_variant(CooVar) The average chromatin accessibility score: 81.708; most accessible tissue: Minghui63 young leaf, score: 88.753 |
| vg0825985205 (J) | chr08 | 25985205 | G | GC | 99.50% | 0.00% | G -> GCGCTTGTC, GC,GCGCTT | NA |
LOC_Os08g41120.1 Alt: GCGCTTGTC| frameshift_variant HIGH(snpEff)
LOC_Os08g41130.1 Alt: GCGCTTGTC| upstream_gene_variant MODIFIER(snpEff) LOC_Os08g41110.1 Alt: GCGCTTGTC| downstream_gene_variant MODIFIER(snpEff) LOC_Os08g41120.1 Alt: GC| frameshift_variant HIGH(snpEff) LOC_Os08g41130.1 Alt: GC| upstream_gene_variant MODIFIER(snpEff) LOC_Os08g41110.1 Alt: GC| downstream_gene_variant MODIFIER(snpEff) LOC_Os08g41120.1 Alt: GCGCTT| frameshift_variant HIGH(snpEff) LOC_Os08g41130.1 Alt: GCGCTT| upstream_gene_variant MODIFIER(snpEff) The average chromatin accessibility score: 81.060; most accessible tissue: Minghui63 young leaf, score: 88.629 |
| vg0825985206 (J) | chr08 | 25985206 | G | GCTTGT | 89.90% | 3.22% | G -> GCTTGT | NA |
LOC_Os08g41120.1 Alt: GCTTGT| frameshift_variant HIGH(snpEff)/frameshift_variant(CooVar)
LOC_Os08g41120.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 80.884; most accessible tissue: Minghui63 young leaf, score: 88.629 |
| STR0825984269 (J) | chr08 | 25984269 | TC | TT | 63.70% | 0.00% | TT -> TC | NA |
|