Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825984563:

Variant ID: vg0825984563 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 25984563
Reference Allele: CAlternative Allele: T,CGAT
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTGTGCACACATCAGCTTCAACCTCTCCAATGCGTACCTGTCCGCCGCCACGAGCAAGCTCTCGAAAAAACCGGTCGTCGTCGACGACGACGACGACGA[C/T,CGAT]
GTCGATGGCGACGGCAAGGCGTCCGTGTACACGAAGTGTAGTAGAGCTTTGAACGTGGCCGGATCGATGTCGTGCAGGGTGACGCACGGCATGGCGGCCT

Reverse complement sequence

AGGCCGCCATGCCGTGCGTCACCCTGCACGACATCGATCCGGCCACGTTCAAAGCTCTACTACACTTCGTGTACACGGACGCCTTGCCGTCGCCATCGAC[G/A,ATCG]
TCGTCGTCGTCGTCGTCGACGACGACCGGTTTTTTCGAGAGCTTGCTCGTGGCGGCGGACAGGTACGCATTGGAGAGGTTGAAGCTGATGTGTGCACAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.50% 35.20% 0.13% 0.17% CGAT: 0.04%
All Indica  2759 98.30% 1.30% 0.14% 0.25% NA
All Japonica  1512 3.20% 96.80% 0.00% 0.00% NA
Aus  269 79.60% 20.10% 0.00% 0.00% CGAT: 0.37%
Indica I  595 99.20% 0.30% 0.17% 0.34% NA
Indica II  465 98.10% 1.70% 0.22% 0.00% NA
Indica III  913 99.30% 0.40% 0.00% 0.22% NA
Indica Intermediate  786 96.70% 2.70% 0.25% 0.38% NA
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 8.30% 91.70% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 53.30% 42.20% 2.22% 1.11% CGAT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825984563 C -> CGAT LOC_Os08g41120.1 disruptive_inframe_insertion ; p.Thr239dup; MODERATE inframe_variant Average:86.682; most accessible tissue: Zhenshan97 young leaf, score: 93.506 N N N N
vg0825984563 C -> T LOC_Os08g41120.1 synonymous_variant ; p.Thr239Thr; LOW synonymous_codon Average:86.682; most accessible tissue: Zhenshan97 young leaf, score: 93.506 N N N N
vg0825984563 C -> DEL LOC_Os08g41120.1 N frameshift_variant Average:86.682; most accessible tissue: Zhenshan97 young leaf, score: 93.506 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0825984563 C CGAT -0.16 -0.13 -0.13 -0.07 -0.1 -0.11
vg0825984563 C T -0.02 -0.02 -0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825984563 NA 1.36E-20 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825984563 NA 5.88E-27 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825984563 NA 4.65E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825984563 NA 1.37E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825984563 NA 1.32E-06 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825984563 NA 6.19E-39 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251