22 variations found. LOC_Os03g03410 (serine%2Fthreonine-protein kinase; putative; expressed), ranging from 1,457,461 bp to 1,461,716 bp (including 0 kb upstream and 0 kb downstream of the gene).
| Color | Explain | Details |
|---|---|---|
| red | High impact variants defined by snpEff | 'STOP_LOST', 'START_LOST', 'STOP_GAINED', 'FRAME_SHIFT' et. al., the details can be found at http://snpef f.sourceforge.net/SnpEff_manual.html#eff. |
| purple | 'Damaging' or 'probably damaging' non-synonymous SNPs defined by PolyPhen-2 | This is a qualitative result of nonsynonymous SNP annotation, where 'damaging' or 'probably damaging' means that the variant is more likely to affect protein function. Details can be found here. |
| Var ID | Chrom | Position | Primary Allele | Secondary Allele | Primary Allele Frequency | DEL Frequency | Var | GWAS Results | Effect |
|---|---|---|---|---|---|---|---|---|---|
| vg0301457522 (J) | chr03 | 1457522 | GCT | GCTCTCT CT | 61.20% | 1.38% | GCTCTCTCTC TCTCTCTCTC T -> GCT,GCTCTC TCT,GCTCTC TCTCTCTCTC TCTCTCT,GC TCTCTCTCTC TCTCTCT,G, GCTCTCT | NA |
LOC_Os03g03410.1 Alt: GCTCTCTCTCTCTCTCTCTCTCT| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g03410.1 Alt: GCTCTCTCT| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) LOC_Os03g03410.1 Alt: GCTCTCTCTCTCTCTCTCT| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03410.1 Alt: G| 5_prime_UTR_variant MODIFIER(snpEff) LOC_Os03g03410.1 Alt: GCTCTCT| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03410.1 Alt: GCT| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301457558 (J) | chr03 | 1457558 | T | A | 77.80% | 0.00% | T -> A |
mr1002 (Jap_All); LR P-value: 4.94E-06;
mr1183 (Jap_All); LR P-value: 2.67E-06; mr1503 (Jap_All); LR P-value: 1.31E-06; mr1797 (All); LR P-value: 7.44E-07; mr1801 (All); LR P-value: 7.44E-07; mr1812 (All); LR P-value: 1.06E-07; mr1832 (All); LR P-value: 2.36E-06; mr1002_2 (Jap_All); LR P-value: 1.41E-09; mr1183_2 (Jap_All); LR P-value: 8.46E-07; mr1449_2 (All); LR P-value: 1.16E-08; mr1691_2 (All); LR P-value: 1.34E-07; mr1851_2 (All); LR P-value: 3.85E-09; mr1905_2 (All); LR P-value: 1.99E-08; mr1915_2 (All); LR P-value: 9.54E-07 |
LOC_Os03g03410.1 Alt: A| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301457807 (J) | chr03 | 1457807 | C | G | 86.50% | 0.00% | G -> C |
LOC_Os03g03410.1 Alt: C| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
|
| vg0301457881 (J) | chr03 | 1457881 | A | G | 99.60% | 0.00% | A -> G | NA |
LOC_Os03g03410.1 Alt: G| missense_variant MODERATE(snpEff)
The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301458142 (J) | chr03 | 1458142 | C | T | 99.60% | 0.00% | C -> T | NA |
LOC_Os03g03410.1 Alt: T| missense_variant MODERATE(snpEff)
The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301458236 (J) | chr03 | 1458236 | G | T | 98.90% | 0.00% | G -> T | NA |
LOC_Os03g03410.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301458391 (J) | chr03 | 1458391 | C | T | 98.80% | 0.00% | C -> T | NA |
LOC_Os03g03410.1 Alt: T| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301458683 (J) | chr03 | 1458683 | G | GTTGGAC | 86.60% | 0.00% | GTTGGAC -> G | NA |
LOC_Os03g03420.1 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g03420.2 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03410.1 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301458767 (J) | chr03 | 1458767 | CT | CTT | 98.00% | 0.00% | CT -> CTT,C,CTTT | NA |
LOC_Os03g03420.1 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g03420.2 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03410.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03420.1 Alt: CTT| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03420.2 Alt: CTT| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03410.1 Alt: CTT| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03420.1 Alt: CTTT| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03420.2 Alt: CTTT| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03410.1 Alt: CTTT| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301458815 (J) | chr03 | 1458815 | C | A | 99.80% | 0.00% | C -> A | NA |
LOC_Os03g03420.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)
LOC_Os03g03420.2 Alt: A| downstream_gene_variant MODIFIER(snpEff) LOC_Os03g03410.1 Alt: A| intron_variant MODIFIER(snpEff) The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301459282 (J) | chr03 | 1459282 | G | A | 86.60% | 0.00% | A -> G |
LOC_Os03g03410.1 Alt: G| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
|
| vg0301459739 (J) | chr03 | 1459739 | GA | GAAA | 98.70% | 0.00% | GA -> G,GAAA | NA |
LOC_Os03g03420.1 Alt: GAAA| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g03420.2 Alt: GAAA| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03410.1 Alt: GAAA| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03420.1 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03420.2 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03410.1 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301459851 (J) | chr03 | 1459851 | C | T | 99.30% | 0.00% | C -> T | NA |
LOC_Os03g03420.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)
LOC_Os03g03420.2 Alt: T| downstream_gene_variant MODIFIER(snpEff) LOC_Os03g03410.1 Alt: T| intron_variant MODIFIER(snpEff) The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301459970 (J) | chr03 | 1459970 | A | G | 77.90% | 0.00% | A -> G |
mr1002 (Jap_All); LR P-value: 4.94E-06;
mr1183 (Jap_All); LR P-value: 2.67E-06; mr1503 (Jap_All); LR P-value: 1.31E-06; mr1797 (All); LR P-value: 9.04E-07; mr1801 (All); LR P-value: 9.04E-07; mr1812 (All); LR P-value: 1.04E-07; mr1832 (All); LR P-value: 2.14E-06; mr1002_2 (Jap_All); LR P-value: 1.41E-09; mr1183_2 (Jap_All); LR P-value: 8.46E-07; mr1691_2 (All); LR P-value: 2.65E-07; mr1905_2 (All); LR P-value: 2.28E-08; mr1915_2 (All); LR P-value: 1.10E-06 |
LOC_Os03g03420.1 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g03420.2 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03410.1 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301460249 (J) | chr03 | 1460249 | A | G | 64.00% | 0.00% | G -> A |
LOC_Os03g03410.1 Alt: A| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
|
| vg0301460920 (J) | chr03 | 1460920 | AC | A | 87.90% | 0.00% | A -> AC | NA |
LOC_Os03g03420.1 Alt: AC| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g03420.2 Alt: AC| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03410.1 Alt: AC| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301461190 (J) | chr03 | 1461190 | G | C | 77.90% | 0.00% | G -> C |
mr1183 (Jap_All); LR P-value: 2.40E-06;
mr1503 (Jap_All); LR P-value: 1.35E-06; mr1797 (All); LR P-value: 7.95E-07; mr1801 (All); LR P-value: 7.95E-07; mr1812 (All); LR P-value: 1.09E-07; mr1832 (All); LR P-value: 2.82E-06; mr1002_2 (Jap_All); LR P-value: 3.08E-09; mr1183_2 (Jap_All); LR P-value: 6.53E-07; mr1449_2 (All); LR P-value: 6.21E-09; mr1691_2 (All); LR P-value: 9.38E-08; mr1720_2 (All); LR P-value: 1.69E-14; mr1851_2 (All); LR P-value: 6.48E-09; mr1905_2 (All); LR P-value: 1.28E-08; mr1915_2 (All); LR P-value: 8.28E-07 |
LOC_Os03g03410.1 Alt: C| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g03420.1 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03420.2 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301461296 (J) | chr03 | 1461296 | C | T | 64.00% | 0.00% | T -> C |
mr1638 (All); LR P-value: 5.55E-28;
mr1979 (All); LR P-value: 1.26E-06; mr1141_2 (All); LR P-value: 6.36E-53; mr1243_2 (All); LR P-value: 1.09E-40; mr1251_2 (All); LR P-value: 7.88E-38; mr1377_2 (All); LR P-value: 6.26E-13; mr1435_2 (All); LR P-value: 4.87E-38; mr1599_2 (All); LR P-value: 1.78E-58; mr1837_2 (All); LR P-value: 3.06E-07 |
LOC_Os03g03410.1 Alt: C| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g03420.1 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03420.2 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301461502 (J) | chr03 | 1461502 | G | C | 64.00% | 0.00% | C -> G |
mr1638 (All); LR P-value: 1.28E-27;
mr1141_2 (All); LR P-value: 1.77E-53; mr1243_2 (All); LR P-value: 1.76E-40; mr1251_2 (All); LR P-value: 2.68E-37; mr1377_2 (All); LR P-value: 8.93E-13; mr1402_2 (All); LR P-value: 2.41E-61; mr1435_2 (All); LR P-value: 1.67E-37; mr1599_2 (All); LR P-value: 7.73E-58; mr1837_2 (All); LR P-value: 2.39E-07 |
LOC_Os03g03410.1 Alt: G| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g03420.1 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g03420.2 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301461524 (J) | chr03 | 1461524 | C | T | 99.30% | 0.00% | C -> T | NA |
LOC_Os03g03410.1 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)
LOC_Os03g03420.1 Alt: T| downstream_gene_variant MODIFIER(snpEff) LOC_Os03g03420.2 Alt: T| downstream_gene_variant MODIFIER(snpEff) The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0301461586 (J) | chr03 | 1461586 | G | A | 99.60% | 0.00% | G -> A | NA |
LOC_Os03g03410.1 Alt: A| 3_prime_UTR_variant MODIFIER(snpEff)
LOC_Os03g03420.1 Alt: A| downstream_gene_variant MODIFIER(snpEff) LOC_Os03g03420.2 Alt: A| downstream_gene_variant MODIFIER(snpEff) The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| STR0301458680 (J) | chr03 | 1458680 | G | GTTGTTG | 80.60% | 0.00% | GTTGTTG -> G | NA |
|