Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0301458767:

Variant ID: vg0301458767 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 1458767
Reference Allele: CTAlternative Allele: CTT,C,CTTT
Primary Allele: CTSecondary Allele: CTT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTGCGATAATGGGTTGTTGGACTTGGATATGATCAGTCTGATGGACCAGGAAGTGAGCTGTCAAAAACTGTGAATTTCCATTTGAAGAAGGGAAAGATC[CT/CTT,C,CTTT]
TTTTTTTTTCTAGTGTATTTGATCGGATTTTTTGTGCATAGAGGTGCAACTTGTTTCAGTTTATTCATGAAGCAGTGGTCTGCTGGTGAACGGTTGGGTC

Reverse complement sequence

GACCCAACCGTTCACCAGCAGACCACTGCTTCATGAATAAACTGAAACAAGTTGCACCTCTATGCACAAAAAATCCGATCAAATACACTAGAAAAAAAAA[AG/AAG,G,AAAG]
GATCTTTCCCTTCTTCAAATGGAAATTCACAGTTTTTGACAGCTCACTTCCTGGTCCATCAGACTGATCATATCCAAGTCCAACAACCCATTATCGCAGA

Allele Frequencies:

Populations Population SizeFrequency of CT(primary allele) Frequency of CTT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.00% 1.10% 0.28% 0.00% C: 0.53%; CTTT: 0.08%
All Indica  2759 99.20% 0.40% 0.22% 0.00% C: 0.11%; CTTT: 0.04%
All Japonica  1512 97.90% 0.60% 0.13% 0.00% C: 1.26%; CTTT: 0.07%
Aus  269 88.80% 8.90% 1.12% 0.00% C: 0.74%; CTTT: 0.37%
Indica I  595 99.50% 0.00% 0.34% 0.00% C: 0.17%
Indica II  465 99.60% 0.00% 0.22% 0.00% C: 0.22%
Indica III  913 99.30% 0.40% 0.11% 0.00% C: 0.11%
Indica Intermediate  786 98.60% 1.00% 0.25% 0.00% CTTT: 0.13%
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 95.60% 0.60% 0.20% 0.00% C: 3.37%; CTTT: 0.20%
Japonica Intermediate  241 97.90% 1.20% 0.00% 0.00% C: 0.83%
VI/Aromatic  96 92.70% 5.20% 1.04% 0.00% C: 1.04%
Intermediate  90 93.30% 4.40% 1.11% 0.00% CTTT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0301458767 CT -> C LOC_Os03g03420.1 downstream_gene_variant ; 4731.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301458767 CT -> C LOC_Os03g03420.2 downstream_gene_variant ; 4731.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301458767 CT -> C LOC_Os03g03410.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301458767 CT -> CTT LOC_Os03g03420.1 downstream_gene_variant ; 4730.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301458767 CT -> CTT LOC_Os03g03420.2 downstream_gene_variant ; 4730.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301458767 CT -> CTT LOC_Os03g03410.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301458767 CT -> CTTT LOC_Os03g03420.1 downstream_gene_variant ; 4730.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301458767 CT -> CTTT LOC_Os03g03420.2 downstream_gene_variant ; 4730.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301458767 CT -> CTTT LOC_Os03g03410.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0301458767 CT C 0.0 0.15 0.11 0.0 0.02 0.04
vg0301458767 CT CTT -0.07 0.02 0.0 -0.01 -0.04 0.05
vg0301458767 CT CTTT -0.22 -0.09 -0.03 -0.1 -0.16 0.01