\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217635489:

Variant ID: vg1217635489 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17635489
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.60, C: 0.39, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTATATTTCTAAATTTGAAAAATTTATCTTTGATAGGCATATTTTAATCCAACAACATATCCTCTTAATGACTTTCTCGGATTTAATACGTGACTCTT[T/C]
ATTCTTCCACACAAGATTGACTACATGGACATCGAGAAATGTAAATATTAATGAATCGCTTGTTTATAATGAATAATTAGTAGCATGTTTAAATGAATGA

Reverse complement sequence

TCATTCATTTAAACATGCTACTAATTATTCATTATAAACAAGCGATTCATTAATATTTACATTTCTCGATGTCCATGTAGTCAATCTTGTGTGGAAGAAT[A/G]
AAGAGTCACGTATTAAATCCGAGAAAGTCATTAAGAGGATATGTTGTTGGATTAAAATATGCCTATCAAAGATAAATTTTTCAAATTTAGAAATATAACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 36.60% 0.61% 4.08% NA
All Indica  2759 77.50% 20.30% 0.54% 1.70% NA
All Japonica  1512 30.50% 61.20% 0.33% 8.00% NA
Aus  269 28.30% 71.00% 0.37% 0.37% NA
Indica I  595 65.00% 34.50% 0.50% 0.00% NA
Indica II  465 77.80% 13.80% 0.86% 7.53% NA
Indica III  913 90.50% 8.50% 0.66% 0.33% NA
Indica Intermediate  786 71.50% 27.10% 0.25% 1.15% NA
Temperate Japonica  767 6.60% 93.20% 0.00% 0.13% NA
Tropical Japonica  504 55.60% 21.80% 0.99% 21.63% NA
Japonica Intermediate  241 53.90% 41.50% 0.00% 4.56% NA
VI/Aromatic  96 60.40% 13.50% 8.33% 17.71% NA
Intermediate  90 45.60% 46.70% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217635489 T -> C LOC_Os12g29580.1 upstream_gene_variant ; 3063.0bp to feature; MODIFIER silent_mutation Average:48.183; most accessible tissue: Zhenshan97 root, score: 88.995 N N N N
vg1217635489 T -> C LOC_Os12g29580.2 upstream_gene_variant ; 3097.0bp to feature; MODIFIER silent_mutation Average:48.183; most accessible tissue: Zhenshan97 root, score: 88.995 N N N N
vg1217635489 T -> C LOC_Os12g29580-LOC_Os12g29590 intergenic_region ; MODIFIER silent_mutation Average:48.183; most accessible tissue: Zhenshan97 root, score: 88.995 N N N N
vg1217635489 T -> DEL N N silent_mutation Average:48.183; most accessible tissue: Zhenshan97 root, score: 88.995 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217635489 NA 3.04E-14 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217635489 NA 5.37E-15 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217635489 NA 9.80E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 3.97E-11 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 1.53E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 7.39E-10 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 1.93E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 1.25E-12 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 6.27E-12 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 1.05E-11 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 7.65E-11 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 7.03E-06 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 7.65E-07 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 8.61E-08 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 1.66E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 8.37E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 4.75E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 7.34E-14 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 6.41E-15 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 6.83E-14 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 7.18E-09 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 4.43E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 6.19E-08 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 4.01E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 3.27E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 5.05E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 3.19E-08 mr1407_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 2.31E-15 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 5.27E-14 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 8.72E-10 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 1.37E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 3.82E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 5.56E-08 mr1869_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635489 NA 4.97E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251