\
| Variant ID: vg1208205606 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8205606 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 241. )
TACTTTAACAGCAGATGAATATTACAACCTTATGGCCGATGAGAGGGAGGATCTAGTCTAGTCGCGATTGCGAGCTCTTGCAAAAGTTACCAAGGATAAG[A/G]
AGCGTGTTGCTCGGCATTACAATAAGAAAGTAGTACCCAAAGATTTTTCGGAGGGGGAACTTGTATGGAAGTTGATTTTGCCGATTGGAACTCGGGATAA
TTATCCCGAGTTCCAATCGGCAAAATCAACTTCCATACAAGTTCCCCCTCCGAAAAATCTTTGGGTACTACTTTCTTATTGTAATGCCGAGCAACACGCT[T/C]
CTTATCCTTGGTAACTTTTGCAAGAGCTCGCAATCGCGACTAGACTAGATCCTCCCTCTCATCGGCCATAAGGTTGTAATATTCATCTGCTGTTAAAGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.70% | 19.60% | 5.56% | 14.16% | NA |
| All Indica | 2759 | 89.50% | 3.90% | 6.09% | 0.51% | NA |
| All Japonica | 1512 | 7.50% | 48.60% | 2.51% | 41.40% | NA |
| Aus | 269 | 74.70% | 14.10% | 9.67% | 1.49% | NA |
| Indica I | 595 | 83.70% | 7.60% | 8.07% | 0.67% | NA |
| Indica II | 465 | 91.60% | 4.70% | 3.01% | 0.65% | NA |
| Indica III | 913 | 92.60% | 0.80% | 6.02% | 0.66% | NA |
| Indica Intermediate | 786 | 89.10% | 4.30% | 6.49% | 0.13% | NA |
| Temperate Japonica | 767 | 8.00% | 72.80% | 1.69% | 17.60% | NA |
| Tropical Japonica | 504 | 7.10% | 18.30% | 1.39% | 73.21% | NA |
| Japonica Intermediate | 241 | 6.60% | 35.30% | 7.47% | 50.62% | NA |
| VI/Aromatic | 96 | 42.70% | 18.80% | 28.12% | 10.42% | NA |
| Intermediate | 90 | 48.90% | 30.00% | 4.44% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208205606 | A -> DEL | N | N | silent_mutation | Average:33.952; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg1208205606 | A -> G | LOC_Os12g14374.1 | downstream_gene_variant ; 631.0bp to feature; MODIFIER | silent_mutation | Average:33.952; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg1208205606 | A -> G | LOC_Os12g14390.1 | downstream_gene_variant ; 748.0bp to feature; MODIFIER | silent_mutation | Average:33.952; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg1208205606 | A -> G | LOC_Os12g14374-LOC_Os12g14390 | intergenic_region ; MODIFIER | silent_mutation | Average:33.952; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208205606 | NA | 4.41E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1208205606 | NA | 5.44E-10 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1208205606 | 3.52E-10 | 2.36E-15 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 3.99E-12 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 1.40E-13 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 4.57E-09 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 7.84E-17 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 1.24E-10 | mr1031 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 9.48E-08 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 1.14E-16 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 3.33E-09 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | 8.86E-17 | 1.74E-23 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | 1.56E-08 | 3.78E-19 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 1.49E-21 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 2.57E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 3.01E-12 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 9.49E-09 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 7.10E-21 | mr1013_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 8.05E-11 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 4.21E-20 | mr1031_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 7.48E-13 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 1.49E-12 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 3.27E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 6.09E-21 | mr1361_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 5.65E-09 | mr1361_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 2.76E-06 | mr1554_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 3.83E-13 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 6.46E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 2.32E-11 | mr1879_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208205606 | NA | 5.23E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |