Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1208112458:

Variant ID: vg1208112458 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 8112458
Reference Allele: GACTAlternative Allele: G,AACT
Primary Allele: GACTSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAGACTGAAAAGCAACATATCGCATCAAATTGTGGAAGGGCCTGTAGCCTTGTGGTTACCAGAGCCTCAAACCTCAGAAGCATCTGAGGTTCTGGGTTC[GACT/G,AACT]
CCCCTTAGAAACGAATTTTCTAGGATATATCAGCGTTTTACTCATAGTGATTAGGGTCCGTCCTTTGATTATTGAGGTGTGTACTCGTTGATCCGAACGG

Reverse complement sequence

CCGTTCGGATCAACGAGTACACACCTCAATAATCAAAGGACGGACCCTAATCACTATGAGTAAAACGCTGATATATCCTAGAAAATTCGTTTCTAAGGGG[AGTC/C,AGTT]
GAACCCAGAACCTCAGATGCTTCTGAGGTTTGAGGCTCTGGTAACCACAAGGCTACAGGCCCTTCCACAATTTGATGCGATATGTTGCTTTTCAGTCTGC

Allele Frequencies:

Populations Population SizeFrequency of GACT(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 5.00% 2.50% 27.13% AACT: 1.33%
All Indica  2759 49.80% 8.40% 1.27% 40.59% NA
All Japonica  1512 81.30% 0.10% 5.03% 9.52% AACT: 4.10%
Aus  269 97.40% 0.70% 1.12% 0.74% NA
Indica I  595 63.20% 9.60% 1.85% 25.38% NA
Indica II  465 62.60% 3.20% 0.43% 33.76% NA
Indica III  913 34.00% 10.30% 1.42% 54.33% NA
Indica Intermediate  786 50.40% 8.30% 1.15% 40.20% NA
Temperate Japonica  767 87.50% 0.10% 4.04% 3.13% AACT: 5.22%
Tropical Japonica  504 76.40% 0.00% 5.56% 18.06% NA
Japonica Intermediate  241 71.80% 0.00% 7.05% 12.03% AACT: 9.13%
VI/Aromatic  96 96.90% 0.00% 0.00% 2.08% AACT: 1.04%
Intermediate  90 76.70% 3.30% 4.44% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208112458 GACT -> DEL N N silent_mutation Average:33.811; most accessible tissue: Callus, score: 81.107 N N N N
vg1208112458 GACT -> AACT LOC_Os12g14260.1 upstream_gene_variant ; 2638.0bp to feature; MODIFIER silent_mutation Average:33.811; most accessible tissue: Callus, score: 81.107 N N N N
vg1208112458 GACT -> AACT LOC_Os12g14250-LOC_Os12g14260 intergenic_region ; MODIFIER silent_mutation Average:33.811; most accessible tissue: Callus, score: 81.107 N N N N
vg1208112458 GACT -> G LOC_Os12g14260.1 upstream_gene_variant ; 2637.0bp to feature; MODIFIER silent_mutation Average:33.811; most accessible tissue: Callus, score: 81.107 N N N N
vg1208112458 GACT -> G LOC_Os12g14250-LOC_Os12g14260 intergenic_region ; MODIFIER silent_mutation Average:33.811; most accessible tissue: Callus, score: 81.107 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1208112458 GACT AACT -0.2 -0.21 -0.15 -0.21 -0.18 -0.16
vg1208112458 GACT G -0.78 -0.5 -0.27 -0.38 -0.46 -0.37

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208112458 NA 2.00E-06 mr1006 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208112458 1.49E-06 6.09E-08 mr1013 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208112458 NA 1.08E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208112458 NA 1.48E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208112458 NA 4.93E-06 mr1052 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208112458 NA 7.24E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251