\
| Variant ID: vg1208087778 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8087778 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 86. )
TGGAATAGTGAAGAGTCATTTATTAATTCCGAGAAAGTCATTAAAATGATAGGTTGTTGGATTGAAATATGACTATCAAAAAATAAATTTTTCAGATTTG[G/A]
AAATATAACTATCAAGACTAGATGGAGAAAGTATATGGCTAGTGGGATCAAGAGCCTGATTAATTATTGTATTTAATGAAAAGTTATATATATTTCATTG
CAATGAAATATATATAACTTTTCATTAAATACAATAATTAATCAGGCTCTTGATCCCACTAGCCATATACTTTCTCCATCTAGTCTTGATAGTTATATTT[C/T]
CAAATCTGAAAAATTTATTTTTTGATAGTCATATTTCAATCCAACAACCTATCATTTTAATGACTTTCTCGGAATTAATAAATGACTCTTCACTATTCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.40% | 34.10% | 0.30% | 22.24% | NA |
| All Indica | 2759 | 40.30% | 49.50% | 0.40% | 9.71% | NA |
| All Japonica | 1512 | 47.80% | 2.20% | 0.13% | 49.87% | NA |
| Aus | 269 | 33.80% | 65.10% | 0.00% | 1.12% | NA |
| Indica I | 595 | 51.60% | 33.60% | 0.84% | 13.95% | NA |
| Indica II | 465 | 55.70% | 38.70% | 0.43% | 5.16% | NA |
| Indica III | 913 | 26.80% | 63.90% | 0.11% | 9.20% | NA |
| Indica Intermediate | 786 | 38.40% | 51.40% | 0.38% | 9.80% | NA |
| Temperate Japonica | 767 | 74.80% | 0.90% | 0.13% | 24.12% | NA |
| Tropical Japonica | 504 | 15.10% | 4.20% | 0.00% | 80.75% | NA |
| Japonica Intermediate | 241 | 30.30% | 2.10% | 0.41% | 67.22% | NA |
| VI/Aromatic | 96 | 83.30% | 10.40% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 47.80% | 28.90% | 1.11% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208087778 | G -> DEL | N | N | silent_mutation | Average:29.423; most accessible tissue: Callus, score: 53.781 | N | N | N | N |
| vg1208087778 | G -> A | LOC_Os12g14230.1 | upstream_gene_variant ; 2980.0bp to feature; MODIFIER | silent_mutation | Average:29.423; most accessible tissue: Callus, score: 53.781 | N | N | N | N |
| vg1208087778 | G -> A | LOC_Os12g14230-LOC_Os12g14240 | intergenic_region ; MODIFIER | silent_mutation | Average:29.423; most accessible tissue: Callus, score: 53.781 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208087778 | NA | 1.53E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1208087778 | NA | 4.80E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1208087778 | 3.12E-09 | 1.58E-17 | mr1002 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | 3.44E-06 | 2.27E-13 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 3.49E-06 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 3.86E-08 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 6.08E-07 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 6.73E-09 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 1.11E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 6.25E-09 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 9.95E-06 | mr1851 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 3.49E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | 2.69E-13 | 2.65E-21 | mr1002_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | 2.68E-10 | 4.39E-21 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 3.73E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 1.26E-09 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 5.01E-08 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 1.47E-10 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 2.42E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 7.93E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 1.81E-09 | mr1361_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 1.31E-07 | mr1502_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 2.56E-07 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 1.17E-08 | mr1540_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 2.46E-08 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 6.10E-08 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 1.61E-09 | mr1742_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 2.45E-13 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 1.27E-08 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208087778 | NA | 1.97E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |