\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208087778:

Variant ID: vg1208087778 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8087778
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAATAGTGAAGAGTCATTTATTAATTCCGAGAAAGTCATTAAAATGATAGGTTGTTGGATTGAAATATGACTATCAAAAAATAAATTTTTCAGATTTG[G/A]
AAATATAACTATCAAGACTAGATGGAGAAAGTATATGGCTAGTGGGATCAAGAGCCTGATTAATTATTGTATTTAATGAAAAGTTATATATATTTCATTG

Reverse complement sequence

CAATGAAATATATATAACTTTTCATTAAATACAATAATTAATCAGGCTCTTGATCCCACTAGCCATATACTTTCTCCATCTAGTCTTGATAGTTATATTT[C/T]
CAAATCTGAAAAATTTATTTTTTGATAGTCATATTTCAATCCAACAACCTATCATTTTAATGACTTTCTCGGAATTAATAAATGACTCTTCACTATTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.40% 34.10% 0.30% 22.24% NA
All Indica  2759 40.30% 49.50% 0.40% 9.71% NA
All Japonica  1512 47.80% 2.20% 0.13% 49.87% NA
Aus  269 33.80% 65.10% 0.00% 1.12% NA
Indica I  595 51.60% 33.60% 0.84% 13.95% NA
Indica II  465 55.70% 38.70% 0.43% 5.16% NA
Indica III  913 26.80% 63.90% 0.11% 9.20% NA
Indica Intermediate  786 38.40% 51.40% 0.38% 9.80% NA
Temperate Japonica  767 74.80% 0.90% 0.13% 24.12% NA
Tropical Japonica  504 15.10% 4.20% 0.00% 80.75% NA
Japonica Intermediate  241 30.30% 2.10% 0.41% 67.22% NA
VI/Aromatic  96 83.30% 10.40% 0.00% 6.25% NA
Intermediate  90 47.80% 28.90% 1.11% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208087778 G -> DEL N N silent_mutation Average:29.423; most accessible tissue: Callus, score: 53.781 N N N N
vg1208087778 G -> A LOC_Os12g14230.1 upstream_gene_variant ; 2980.0bp to feature; MODIFIER silent_mutation Average:29.423; most accessible tissue: Callus, score: 53.781 N N N N
vg1208087778 G -> A LOC_Os12g14230-LOC_Os12g14240 intergenic_region ; MODIFIER silent_mutation Average:29.423; most accessible tissue: Callus, score: 53.781 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208087778 NA 1.53E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208087778 NA 4.80E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208087778 3.12E-09 1.58E-17 mr1002 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 3.44E-06 2.27E-13 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 3.49E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 3.86E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 6.08E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 6.73E-09 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 1.11E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 6.25E-09 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 9.95E-06 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 3.49E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 2.69E-13 2.65E-21 mr1002_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 2.68E-10 4.39E-21 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 3.73E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 1.26E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 5.01E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 1.47E-10 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 2.42E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 7.93E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 1.81E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 1.31E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 2.56E-07 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 1.17E-08 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 2.46E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 6.10E-08 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 1.61E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 2.45E-13 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 1.27E-08 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208087778 NA 1.97E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251