\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208070376:

Variant ID: vg1208070376 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8070376
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.56, A: 0.45, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CATGAACATATATAGCAGAGACAGCTCTTCTTTTGATACCTCTCTCGACAATTTCTGTAGTACGTCCTCCCTCTCTTTCAGGTTATTACAAGATGACTTT[A/G]
GTCAAACTCAAACTATTTCAAGTTTAACCAAGTCTATAAAAAAATAGTAATATTTTTGACCTAAGATAAATTTAGTATAAAAATATATTTAATTATTAAT

Reverse complement sequence

ATTAATAATTAAATATATTTTTATACTAAATTTATCTTAGGTCAAAAATATTACTATTTTTTTATAGACTTGGTTAAACTTGAAATAGTTTGAGTTTGAC[T/C]
AAAGTCATCTTGTAATAACCTGAAAGAGAGGGAGGACGTACTACAGAAATTGTCGAGAGAGGTATCAAAAGAAGAGCTGTCTCTGCTATATATGTTCATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 16.00% 0.32% 19.09% NA
All Indica  2759 93.70% 2.40% 0.36% 3.48% NA
All Japonica  1512 5.80% 42.50% 0.26% 51.52% NA
Aus  269 97.80% 1.50% 0.00% 0.74% NA
Indica I  595 95.00% 4.20% 0.17% 0.67% NA
Indica II  465 94.80% 3.40% 0.22% 1.51% NA
Indica III  913 92.40% 0.70% 0.55% 6.35% NA
Indica Intermediate  786 93.60% 2.50% 0.38% 3.44% NA
Temperate Japonica  767 6.50% 67.80% 0.26% 25.42% NA
Tropical Japonica  504 5.20% 11.70% 0.40% 82.74% NA
Japonica Intermediate  241 4.60% 26.10% 0.00% 69.29% NA
VI/Aromatic  96 72.90% 19.80% 0.00% 7.29% NA
Intermediate  90 52.20% 26.70% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208070376 A -> DEL N N silent_mutation Average:39.317; most accessible tissue: Zhenshan97 flower, score: 61.362 N N N N
vg1208070376 A -> G LOC_Os12g14210.1 upstream_gene_variant ; 3214.0bp to feature; MODIFIER silent_mutation Average:39.317; most accessible tissue: Zhenshan97 flower, score: 61.362 N N N N
vg1208070376 A -> G LOC_Os12g14200.1 downstream_gene_variant ; 1794.0bp to feature; MODIFIER silent_mutation Average:39.317; most accessible tissue: Zhenshan97 flower, score: 61.362 N N N N
vg1208070376 A -> G LOC_Os12g14200-LOC_Os12g14210 intergenic_region ; MODIFIER silent_mutation Average:39.317; most accessible tissue: Zhenshan97 flower, score: 61.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208070376 NA 1.95E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208070376 NA 1.16E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208070376 1.47E-10 1.48E-15 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 3.07E-13 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 2.21E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 1.84E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 3.26E-16 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 7.75E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 3.33E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 1.62E-16 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 7.52E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 2.91E-22 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 5.94E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 3.80E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 3.50E-15 8.93E-23 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 4.18E-08 3.27E-19 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 1.55E-24 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 1.26E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 2.35E-06 2.57E-15 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 3.73E-06 2.83E-12 mr1011_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 1.09E-06 8.06E-23 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 2.43E-11 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 2.13E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 1.13E-06 1.34E-21 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 3.07E-06 1.30E-13 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 1.85E-14 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 5.72E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 9.81E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 2.73E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 9.78E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 3.66E-17 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 4.48E-09 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 6.89E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 5.47E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 3.42E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 8.86E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 5.02E-13 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 3.77E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 8.92E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 1.29E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208070376 NA 1.77E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251