\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121916188:

Variant ID: vg1121916188 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21916188
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCTCTCGGACTGAGTTTGGTTCGTACTCTATTTCTCAACTAGTGTATATTAAATCCTCCATCGTTTTAACCTTTAAGAGAGACTAGAAAAATACCCGTG[T/C]
GTTGTACTGGGTAAAAGGTTGATGAAAGAGAAAGAGGGCGCTGTCAATAAAAGCAGAGCGAGGGAGCAGTGTGAAAAGTGAAACCGTCAGTAAAAATTGA

Reverse complement sequence

TCAATTTTTACTGACGGTTTCACTTTTCACACTGCTCCCTCGCTCTGCTTTTATTGACAGCGCCCTCTTTCTCTTTCATCAACCTTTTACCCAGTACAAC[A/G]
CACGGGTATTTTTCTAGTCTCTCTTAAAGGTTAAAACGATGGAGGATTTAATATACACTAGTTGAGAAATAGAGTACGAACCAAACTCAGTCCGAGAGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.90% 16.80% 5.69% 0.59% NA
All Indica  2759 95.30% 0.60% 3.73% 0.40% NA
All Japonica  1512 43.80% 50.50% 5.09% 0.66% NA
Aus  269 72.50% 1.10% 24.91% 1.49% NA
Indica I  595 99.00% 0.70% 0.17% 0.17% NA
Indica II  465 99.10% 0.40% 0.22% 0.22% NA
Indica III  913 92.10% 0.50% 7.23% 0.11% NA
Indica Intermediate  786 93.80% 0.80% 4.45% 1.02% NA
Temperate Japonica  767 25.00% 71.40% 3.39% 0.13% NA
Tropical Japonica  504 76.20% 15.70% 6.75% 1.39% NA
Japonica Intermediate  241 35.70% 56.40% 7.05% 0.83% NA
VI/Aromatic  96 81.20% 0.00% 18.75% 0.00% NA
Intermediate  90 78.90% 13.30% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121916188 T -> DEL N N silent_mutation Average:59.125; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1121916188 T -> C LOC_Os11g37120.1 upstream_gene_variant ; 205.0bp to feature; MODIFIER silent_mutation Average:59.125; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1121916188 T -> C LOC_Os11g37130.1 downstream_gene_variant ; 3971.0bp to feature; MODIFIER silent_mutation Average:59.125; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1121916188 T -> C LOC_Os11g37120-LOC_Os11g37130 intergenic_region ; MODIFIER silent_mutation Average:59.125; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1121916188 T C -0.07 -0.11 -0.12 0.0 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121916188 NA 5.32E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1121916188 NA 2.92E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1121916188 NA 7.98E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1121916188 NA 4.49E-23 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 3.15E-29 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 1.47E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 7.10E-08 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 7.08E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 1.48E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 8.19E-07 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 1.40E-23 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 7.13E-26 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 2.18E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 1.40E-21 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 1.43E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 2.03E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 3.26E-15 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 2.54E-08 mr1740 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 5.14E-15 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 5.14E-07 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 2.65E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 1.18E-22 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 3.48E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 5.37E-23 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121916188 NA 6.61E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251