\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006058550:

Variant ID: vg1006058550 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6058550
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGGGAGGCTAAAGGTCCTTTCGCATAAAGCCGGCATTTCAAAGCAGTAGTTGAAAGCAGTAAAAAAGTTGTAGTAATTAACCCATATTAACCAATCACT[G/A]
TCCAACGCTACACCACGTTGCAACAGGCCCAAACCACCACCTGAACTAACCAGTTCCAAAAGCTAACTAGGGGTGAAACTAATCACGGTGAATCTGGTCG

Reverse complement sequence

CGACCAGATTCACCGTGATTAGTTTCACCCCTAGTTAGCTTTTGGAACTGGTTAGTTCAGGTGGTGGTTTGGGCCTGTTGCAACGTGGTGTAGCGTTGGA[C/T]
AGTGATTGGTTAATATGGGTTAATTACTACAACTTTTTTACTGCTTTCAACTACTGCTTTGAAATGCCGGCTTTATGCGAAAGGACCTTTAGCCTCCCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.60% 0.30% 7.28% 72.83% NA
All Indica  2759 2.70% 0.00% 6.34% 90.94% NA
All Japonica  1512 51.60% 0.70% 8.99% 38.69% NA
Aus  269 1.50% 0.00% 5.20% 93.31% NA
Indica I  595 1.50% 0.00% 1.34% 97.14% NA
Indica II  465 1.90% 0.00% 5.81% 92.26% NA
Indica III  913 3.30% 0.00% 8.76% 87.95% NA
Indica Intermediate  786 3.40% 0.00% 7.63% 88.93% NA
Temperate Japonica  767 78.20% 1.40% 8.34% 11.99% NA
Tropical Japonica  504 12.90% 0.00% 11.11% 75.99% NA
Japonica Intermediate  241 47.70% 0.00% 6.64% 45.64% NA
VI/Aromatic  96 41.70% 1.00% 11.46% 45.83% NA
Intermediate  90 32.20% 0.00% 8.89% 58.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006058550 G -> A LOC_Os10g10950.1 synonymous_variant ; p.Asp68Asp; LOW synonymous_codon Average:5.316; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 N N N N
vg1006058550 G -> DEL LOC_Os10g10950.1 N frameshift_variant Average:5.316; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006058550 NA 1.19E-06 mr1006 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006058550 4.57E-06 3.49E-07 mr1013 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006058550 NA 3.23E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006058550 1.60E-06 1.28E-07 mr1034 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006058550 NA 1.60E-06 mr1052 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006058550 NA 1.16E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006058550 NA 1.38E-06 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006058550 NA 1.26E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251