Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804334416:

Variant ID: vg0804334416 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 4334416
Reference Allele: CTAlternative Allele: C
Primary Allele: CTSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTAGGACTTGAGCGGGCCGACGTAGGCCTCGAACCCCAGCGTGGTCATGGCCCAGAGGAGGTCGTCGCCGTTGATGGTCTTCCGCTTCTCGCGCTGGCA[CT/C]
TGTCGGAGGCCTCGCCTGTAACGAAGCTGATGAACTCCGACACGCACTCCTGCACCGTCTCCTTCGACTCCTTGGAGATCTTGGCGTTCGCCGGCAGCGA

Reverse complement sequence

TCGCTGCCGGCGAACGCCAAGATCTCCAAGGAGTCGAAGGAGACGGTGCAGGAGTGCGTGTCGGAGTTCATCAGCTTCGTTACAGGCGAGGCCTCCGACA[AG/G]
TGCCAGCGCGAGAAGCGGAAGACCATCAACGGCGACGACCTCCTCTGGGCCATGACCACGCTGGGGTTCGAGGCCTACGTCGGCCCGCTCAAGTCCTACC

Allele Frequencies:

Populations Population SizeFrequency of CT(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.30% 3.30% 10.47% 3.94% NA
All Indica  2759 72.50% 5.20% 16.24% 6.09% NA
All Japonica  1512 96.40% 0.50% 2.31% 0.73% NA
Aus  269 97.80% 0.00% 1.49% 0.74% NA
Indica I  595 72.80% 5.90% 17.82% 3.53% NA
Indica II  465 44.10% 13.50% 26.02% 16.34% NA
Indica III  913 88.30% 0.10% 9.97% 1.64% NA
Indica Intermediate  786 70.60% 5.70% 16.54% 7.12% NA
Temperate Japonica  767 94.50% 0.50% 4.04% 0.91% NA
Tropical Japonica  504 98.20% 0.40% 0.79% 0.60% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 83.30% 3.30% 8.89% 4.44% NA

QTN in RiceNavi

Rice quantitative trait nucleotides (QTNs) and inferred QTN effects are from Wei et al., Nature Genetics, 2021.

CategoryVariant IDChromPosGeneMSURAPAlt_Allele_FunctionRef_genoAlt_geno
Heading datevg0804334416Chr84334416Ghd8LOC_Os08g07740Os08g0174500promoting heading date under LDCTC

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804334416 CT -> C LOC_Os08g07740.1 frameshift_variant ; p.Lys108fs; HIGH frameshift_variant Average:83.214; most accessible tissue: Zhenshan97 young leaf, score: 93.764 N N N N
vg0804334416 CT -> DEL LOC_Os08g07740.1 N frameshift_variant Average:83.214; most accessible tissue: Zhenshan97 young leaf, score: 93.764 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0804334416 CT C -0.04 -0.02 0.0 0.0 0.05 0.13