Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729627357:

Variant ID: vg0729627357 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 29627357
Reference Allele: AGAACGTTG	Alternative Allele: A
Primary Allele: AGAACGTTG	Secondary Allele: A

Inferred Ancestral Allele : AGAACGTTG (evidence from allele frequency in Oryza rufipogon: AGAACGTTG: 1.00, others allele: 0.00, population size: 132. )

Flanking Sequence (100 bp) in Reference Genome:

ACGGATTCTGCTTACAACATGAAGTCAAACTCAGATGCTGCACCAATAAAACAAGGTTCTAATGGTAGTAGCAATAACAATGACATGGGTTCCACTACAA[AGAACGTTG/A]
TGACAAAGCCTAGTACAAATAAGGAGAGAGTAATGTCACCCTCAGCTGTTAAGGCTAATGGACACACATCAGCATTTCATCCTGCACAGCACTGGACGTC

Reverse complement sequence

GACGTCCAGTGCTGTGCAGGATGAAATGCTGATGTGTGTCCATTAGCCTTAACAGCTGAGGGTGACATTACTCTCTCCTTATTTGTACTAGGCTTTGTCA[CAACGTTCT/T]
TTGTAGTGGAACCCATGTCATTGTTATTGCTACTACCATTAGAACCTTGTTTTATTGGTGCAGCATCTGAGTTTGACTTCATGTTGTAAGCAGAATCCGT

Allele Frequencies:

Populations	Population Size	Frequency of AGAACGTTG(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	6.70%	2.35%	0.00%	NA
All Indica	2759	84.80%	11.30%	3.84%	0.00%	NA
All Japonica	1512	99.60%	0.20%	0.20%	0.00%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	50.40%	38.20%	11.43%	0.00%	NA
Indica II	465	91.00%	4.90%	4.09%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	89.60%	8.00%	2.42%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	0.00%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

QTN in RiceNavi

Rice quantitative trait nucleotides (QTNs) and inferred QTN effects are from Wei et al., Nature Genetics, 2021.

Category	Variant ID	Chrom	Pos	Gene	MSU	RAP	Alt_Allele_Function	Ref_geno	Alt_geno
Heading date	vg0729627357	Chr7	29627357	OsPRR37/Hd2/Ghd7.1	LOC_Os07g49460	Os07g0695100	promoting heading date under LD	AGAACGTTG	A

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0729627357	AGAACGTTG -> A	LOC_Os07g49460.1	frameshift_variant ; p.Lys505fs; HIGH	frameshift_variant	Average:75.016; most accessible tissue: Minghui63 flag leaf, score: 88.687	N	N	N	N
vg0729627357	AGAACGTTG -> A	LOC_Os07g49460.3	frameshift_variant ; p.Lys505fs; HIGH	frameshift_variant	Average:75.016; most accessible tissue: Minghui63 flag leaf, score: 88.687	N	N	N	N
vg0729627357	AGAACGTTG -> A	LOC_Os07g49460.4	frameshift_variant ; p.Lys505fs; HIGH	frameshift_variant	Average:75.016; most accessible tissue: Minghui63 flag leaf, score: 88.687	N	N	N	N
vg0729627357	AGAACGTTG -> A	LOC_Os07g49460.2	frameshift_variant ; p.Lys505fs; HIGH	frameshift_variant	Average:75.016; most accessible tissue: Minghui63 flag leaf, score: 88.687	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0729627357	AGAAC*	A	0.05	-0.13	-0.02	0.08	0.12	0.03