\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719775322:

Variant ID: vg0719775322 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19775322
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


AACTGATAATATGCAAAATGTTATATTAGATATTCAAAGTTGTTCGATTAAGATTTCAATATATGCAAAACCACCTTAGACGGTAATATGAATGGTATTG[T/C]
AAATTTTAGGGGGTTGGATGTCCAGTTTAAAGTTCAAGGTACTAGATGGACTTTCATCTAAAGTTTAGACGGTAATATGAACGGTATTGCAAATTTTAGG

Reverse complement sequence

CCTAAAATTTGCAATACCGTTCATATTACCGTCTAAACTTTAGATGAAAGTCCATCTAGTACCTTGAACTTTAAACTGGACATCCAACCCCCTAAAATTT[A/G]
CAATACCATTCATATTACCGTCTAAGGTGGTTTTGCATATATTGAAATCTTAATCGAACAACTTTGAATATCTAATATAACATTTTGCATATTATCAGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 37.90% 2.48% 0.00% NA
All Indica  2759 66.30% 29.80% 3.84% 0.00% NA
All Japonica  1512 44.20% 55.50% 0.26% 0.00% NA
Aus  269 68.40% 30.90% 0.74% 0.00% NA
Indica I  595 71.40% 21.00% 7.56% 0.00% NA
Indica II  465 63.40% 32.50% 4.09% 0.00% NA
Indica III  913 66.80% 31.90% 1.31% 0.00% NA
Indica Intermediate  786 63.60% 32.60% 3.82% 0.00% NA
Temperate Japonica  767 42.10% 57.60% 0.26% 0.00% NA
Tropical Japonica  504 56.20% 43.80% 0.00% 0.00% NA
Japonica Intermediate  241 26.10% 73.00% 0.83% 0.00% NA
VI/Aromatic  96 83.30% 15.60% 1.04% 0.00% NA
Intermediate  90 58.90% 36.70% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719775322 T -> C LOC_Os07g33110.1 upstream_gene_variant ; 1835.0bp to feature; MODIFIER silent_mutation Average:45.079; most accessible tissue: Callus, score: 86.598 N N N N
vg0719775322 T -> C LOC_Os07g33120.1 upstream_gene_variant ; 4177.0bp to feature; MODIFIER silent_mutation Average:45.079; most accessible tissue: Callus, score: 86.598 N N N N
vg0719775322 T -> C LOC_Os07g33110.4 upstream_gene_variant ; 1949.0bp to feature; MODIFIER silent_mutation Average:45.079; most accessible tissue: Callus, score: 86.598 N N N N
vg0719775322 T -> C LOC_Os07g33110.2 upstream_gene_variant ; 818.0bp to feature; MODIFIER silent_mutation Average:45.079; most accessible tissue: Callus, score: 86.598 N N N N
vg0719775322 T -> C LOC_Os07g33110.3 upstream_gene_variant ; 818.0bp to feature; MODIFIER silent_mutation Average:45.079; most accessible tissue: Callus, score: 86.598 N N N N
vg0719775322 T -> C LOC_Os07g33110.5 upstream_gene_variant ; 818.0bp to feature; MODIFIER silent_mutation Average:45.079; most accessible tissue: Callus, score: 86.598 N N N N
vg0719775322 T -> C LOC_Os07g33110-LOC_Os07g33120 intergenic_region ; MODIFIER silent_mutation Average:45.079; most accessible tissue: Callus, score: 86.598 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719775322 2.92E-06 NA Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719775322 2.21E-06 NA Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719775322 8.97E-06 NA Plant_height Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719775322 1.01E-08 NA Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719775322 2.68E-07 NA Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719775322 1.20E-07 1.09E-23 mr1679 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719775322 NA 7.39E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719775322 NA 3.12E-09 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719775322 NA 2.13E-11 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719775322 NA 1.98E-06 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719775322 NA 4.25E-22 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719775322 NA 1.60E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719775322 NA 3.33E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719775322 NA 9.16E-10 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251