\
| Variant ID: vg0719775322 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19775322 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 78. )
AACTGATAATATGCAAAATGTTATATTAGATATTCAAAGTTGTTCGATTAAGATTTCAATATATGCAAAACCACCTTAGACGGTAATATGAATGGTATTG[T/C]
AAATTTTAGGGGGTTGGATGTCCAGTTTAAAGTTCAAGGTACTAGATGGACTTTCATCTAAAGTTTAGACGGTAATATGAACGGTATTGCAAATTTTAGG
CCTAAAATTTGCAATACCGTTCATATTACCGTCTAAACTTTAGATGAAAGTCCATCTAGTACCTTGAACTTTAAACTGGACATCCAACCCCCTAAAATTT[A/G]
CAATACCATTCATATTACCGTCTAAGGTGGTTTTGCATATATTGAAATCTTAATCGAACAACTTTGAATATCTAATATAACATTTTGCATATTATCAGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.60% | 37.90% | 2.48% | 0.00% | NA |
| All Indica | 2759 | 66.30% | 29.80% | 3.84% | 0.00% | NA |
| All Japonica | 1512 | 44.20% | 55.50% | 0.26% | 0.00% | NA |
| Aus | 269 | 68.40% | 30.90% | 0.74% | 0.00% | NA |
| Indica I | 595 | 71.40% | 21.00% | 7.56% | 0.00% | NA |
| Indica II | 465 | 63.40% | 32.50% | 4.09% | 0.00% | NA |
| Indica III | 913 | 66.80% | 31.90% | 1.31% | 0.00% | NA |
| Indica Intermediate | 786 | 63.60% | 32.60% | 3.82% | 0.00% | NA |
| Temperate Japonica | 767 | 42.10% | 57.60% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 56.20% | 43.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 26.10% | 73.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 15.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 36.70% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719775322 | T -> C | LOC_Os07g33110.1 | upstream_gene_variant ; 1835.0bp to feature; MODIFIER | silent_mutation | Average:45.079; most accessible tissue: Callus, score: 86.598 | N | N | N | N |
| vg0719775322 | T -> C | LOC_Os07g33120.1 | upstream_gene_variant ; 4177.0bp to feature; MODIFIER | silent_mutation | Average:45.079; most accessible tissue: Callus, score: 86.598 | N | N | N | N |
| vg0719775322 | T -> C | LOC_Os07g33110.4 | upstream_gene_variant ; 1949.0bp to feature; MODIFIER | silent_mutation | Average:45.079; most accessible tissue: Callus, score: 86.598 | N | N | N | N |
| vg0719775322 | T -> C | LOC_Os07g33110.2 | upstream_gene_variant ; 818.0bp to feature; MODIFIER | silent_mutation | Average:45.079; most accessible tissue: Callus, score: 86.598 | N | N | N | N |
| vg0719775322 | T -> C | LOC_Os07g33110.3 | upstream_gene_variant ; 818.0bp to feature; MODIFIER | silent_mutation | Average:45.079; most accessible tissue: Callus, score: 86.598 | N | N | N | N |
| vg0719775322 | T -> C | LOC_Os07g33110.5 | upstream_gene_variant ; 818.0bp to feature; MODIFIER | silent_mutation | Average:45.079; most accessible tissue: Callus, score: 86.598 | N | N | N | N |
| vg0719775322 | T -> C | LOC_Os07g33110-LOC_Os07g33120 | intergenic_region ; MODIFIER | silent_mutation | Average:45.079; most accessible tissue: Callus, score: 86.598 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719775322 | 2.92E-06 | NA | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0719775322 | 2.21E-06 | NA | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0719775322 | 8.97E-06 | NA | Plant_height | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0719775322 | 1.01E-08 | NA | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0719775322 | 2.68E-07 | NA | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0719775322 | 1.20E-07 | 1.09E-23 | mr1679 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719775322 | NA | 7.39E-09 | mr1679 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719775322 | NA | 3.12E-09 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719775322 | NA | 2.13E-11 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719775322 | NA | 1.98E-06 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719775322 | NA | 4.25E-22 | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719775322 | NA | 1.60E-06 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719775322 | NA | 3.33E-08 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719775322 | NA | 9.16E-10 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |