Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609338004:

Variant ID: vg0609338004 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 9338004
Reference Allele: CTT	Alternative Allele: C
Primary Allele: CTT	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTAAGCCCATCTATATATCATTGCAGGGTCTCTGACACCTGCAATCTCCTTATGATTCGCATATTTCAGTGACCATTTGCCGATTCCATCTCAGATAT[CTT/C]
TCTCATCAATGGAGGCGGGTATAGTACCAGACAGCACGGTGATAGATATGCCAAATTCCAGAATCCTGACACCTGCTGGAGCAATCAATCTCTTCTCAGG

Reverse complement sequence

CCTGAGAAGAGATTGATTGCTCCAGCAGGTGTCAGGATTCTGGAATTTGGCATATCTATCACCGTGCTGTCTGGTACTATACCCGCCTCCATTGATGAGA[AAG/G]
ATATCTGAGATGGAATCGGCAAATGGTCACTGAAATATGCGAATCATAAGGAGATTGCAGGTGTCAGAGACCCTGCAATGATATATAGATGGGCTTAATT

Allele Frequencies:

Populations	Population Size	Frequency of CTT(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.40%	22.10%	1.50%	0.00%	NA
All Indica	2759	87.30%	12.00%	0.65%	0.00%	NA
All Japonica	1512	67.10%	29.70%	3.24%	0.00%	NA
Aus	269	15.20%	84.00%	0.74%	0.00%	NA
Indica I	595	86.20%	12.60%	1.18%	0.00%	NA
Indica II	465	84.50%	14.40%	1.08%	0.00%	NA
Indica III	913	93.40%	6.20%	0.33%	0.00%	NA
Indica Intermediate	786	82.70%	16.90%	0.38%	0.00%	NA
Temperate Japonica	767	92.00%	4.60%	3.39%	0.00%	NA
Tropical Japonica	504	19.80%	78.00%	2.18%	0.00%	NA
Japonica Intermediate	241	86.30%	8.70%	4.98%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	61.10%	36.70%	2.22%	0.00%	NA

QTN in RiceNavi

Rice quantitative trait nucleotides (QTNs) and inferred QTN effects are from Wei et al., Nature Genetics, 2021.

Category	Variant ID	Chrom	Pos	Gene	MSU	RAP	Alt_Allele_Function	Ref_geno	Alt_geno
Heading date	vg0609338004	Chr6	9338004	Hd1	LOC_Os06g16370	Os06g0275000	promoting heading date under LD	CTT	C

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0609338004	CTT -> C	LOC_Os06g16370.1	frameshift_variant ; p.Phe279fs; HIGH	frameshift_variant	Average:70.908; most accessible tissue: Zhenshan97 panicle, score: 89.846	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0609338004	CTT	C	-0.2	0.05	0.05	0.08	0.09	0.15