Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602235191:

Variant ID: vg0602235191 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 2235191
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

TGATGGAAGACTCAAAGGAGTACAGTTGGCATAAAACGGGGCCAATATGCTACCAGCTGGAGGGCACGGACCAGAATAAGGCTTATAGACAAGGCCTTCC[A/G]
AAGGAGACATGACAGGGACAAGCCATTGATTTTGAGGTGGTTGAAGTTGAACGCCCCAGTTATTTTGTTTGTTATCAGAAGCAACAGGTGTAGCTCGACG

Reverse complement sequence

CGTCGAGCTACACCTGTTGCTTCTGATAACAAACAAAATAACTGGGGCGTTCAACTTCAACCACCTCAAAATCAATGGCTTGTCCCTGTCATGTCTCCTT[T/C]
GGAAGGCCTTGTCTATAAGCCTTATTCTGGTCCGTGCCCTCCAGCTGGTAGCATATTGGCCCCGTTTTATGCCAACTGTACTCCTTTGAGTCTTCCATCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.20%	18.50%	1.35%	0.00%	NA
All Indica	2759	91.30%	8.20%	0.54%	0.00%	NA
All Japonica	1512	55.30%	41.60%	3.11%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.20%	0.50%	0.34%	0.00%	NA
Indica II	465	61.90%	37.40%	0.65%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	92.60%	6.10%	1.27%	0.00%	NA
Temperate Japonica	767	33.10%	61.90%	4.95%	0.00%	NA
Tropical Japonica	504	86.90%	12.10%	0.99%	0.00%	NA
Japonica Intermediate	241	59.80%	38.60%	1.66%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	81.10%	16.70%	2.22%	0.00%	NA

QTN in RiceNavi

Rice quantitative trait nucleotides (QTNs) and inferred QTN effects are from Wei et al., Nature Genetics, 2021.

Category	Variant ID	Chrom	Pos	Gene	MSU	RAP	Alt_Allele_Function	Ref_geno	Alt_geno
Heading date	vg0602235191	Chr6	2235191	Hd17/Hd3b	LOC_Os06g05060	Os06g0142600	delaying heading date	A	G

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0602235191	A -> G	LOC_Os06g05060.1	missense_variant ; p.Leu558Ser; MODERATE	nonsynonymous_codon ; L558S	Average:81.802; most accessible tissue: Minghui63 flag leaf, score: 88.342	possibly damaging	-1.521	TOLERATED	1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0602235191	A	G	0.0	0.03	0.03	-0.01	0.01	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0602235191	7.83E-06	6.18E-19	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602235191	NA	1.63E-06	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602235191	NA	5.10E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602235191	NA	2.49E-19	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602235191	NA	8.56E-09	mr1934_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251