Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517887044:

Variant ID: vg0517887044 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 17887044
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAACTGTGATTGACTTGTGACAAAATTATTGTACAAGTTTTTCAAATATAAATATTATAGGGTAAAGCAGTGATCAGCATATTTATTGTCTTTCGGTC[C/A]
AAAAACACATCTATTATCTGACATGAAAAATAGAAGATAAAAAGATGTGGTAATTATACTTACTCAGGATCTTGGTACACACTACTACTGAACCCATGAG

Reverse complement sequence

CTCATGGGTTCAGTAGTAGTGTGTACCAAGATCCTGAGTAAGTATAATTACCACATCTTTTTATCTTCTATTTTTCATGTCAGATAATAGATGTGTTTTT[G/T]
GACCGAAAGACAATAAATATGCTGATCACTGCTTTACCCTATAATATTTATATTTGAAAAACTTGTACAATAATTTTGTCACAAGTCAATCACAGTTTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.00%	11.00%	0.00%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	66.50%	33.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	38.10%	61.90%	0.00%	0.00%	NA
Tropical Japonica	504	97.80%	2.20%	0.00%	0.00%	NA
Japonica Intermediate	241	91.30%	8.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517887044	C -> A	LOC_Os05g30810.1	upstream_gene_variant ; 4796.0bp to feature; MODIFIER	silent_mutation	Average:54.292; most accessible tissue: Callus, score: 75.168	N	N	N	N
vg0517887044	C -> A	LOC_Os05g30810.2	upstream_gene_variant ; 4796.0bp to feature; MODIFIER	silent_mutation	Average:54.292; most accessible tissue: Callus, score: 75.168	N	N	N	N
vg0517887044	C -> A	LOC_Os05g30830.1	downstream_gene_variant ; 4925.0bp to feature; MODIFIER	silent_mutation	Average:54.292; most accessible tissue: Callus, score: 75.168	N	N	N	N
vg0517887044	C -> A	LOC_Os05g30820.1	intron_variant ; MODIFIER	silent_mutation	Average:54.292; most accessible tissue: Callus, score: 75.168	N	N	N	N
vg0517887044	C -> A	LOC_Os05g30820.2	intron_variant ; MODIFIER	silent_mutation	Average:54.292; most accessible tissue: Callus, score: 75.168	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517887044	NA	4.15E-14	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0517887044	NA	5.97E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517887044	NA	1.71E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517887044	NA	1.58E-11	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517887044	NA	2.60E-10	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517887044	NA	9.04E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517887044	NA	7.93E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517887044	NA	2.71E-06	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517887044	NA	3.85E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517887044	NA	1.05E-08	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517887044	NA	2.43E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251