\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501528934:

Variant ID: vg0501528934 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1528934
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGGTTATGTGAGTAGATTCATGGAGAAACCCACTACCGAGCATCTGGCAGCCGTGAAACGTGTGCTGCGCTATGTCGCCGGCACCATCAATCGCGGCTG[T/C]
AGCTACCGGAGGAAGAAAGGAGCTGTTCATCTAGTTGGATTCAGTGACAGCGATCTCGCCGGCGACGTCGACACGCGGAAAAGCACCACCGGTGTCTTCT

Reverse complement sequence

AGAAGACACCGGTGGTGCTTTTCCGCGTGTCGACGTCGCCGGCGAGATCGCTGTCACTGAATCCAACTAGATGAACAGCTCCTTTCTTCCTCCGGTAGCT[A/G]
CAGCCGCGATTGATGGTGCCGGCGACATAGCGCAGCACACGTTTCACGGCTGCCAGATGCTCGGTAGTGGGTTTCTCCATGAATCTACTCACATAACCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.60% 12.30% 23.70% 35.38% NA
All Indica  2759 16.90% 3.50% 27.40% 52.19% NA
All Japonica  1512 55.80% 30.90% 10.32% 2.98% NA
Aus  269 2.20% 0.70% 64.68% 32.34% NA
Indica I  595 7.70% 0.00% 7.90% 84.37% NA
Indica II  465 37.40% 1.30% 20.86% 40.43% NA
Indica III  913 10.40% 8.30% 46.66% 34.61% NA
Indica Intermediate  786 19.30% 1.80% 23.66% 55.22% NA
Temperate Japonica  767 91.70% 3.10% 4.04% 1.17% NA
Tropical Japonica  504 7.50% 72.80% 14.68% 4.96% NA
Japonica Intermediate  241 42.70% 31.50% 21.16% 4.56% NA
VI/Aromatic  96 2.10% 1.00% 12.50% 84.38% NA
Intermediate  90 37.80% 16.70% 24.44% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501528934 T -> DEL LOC_Os05g03600.1 N frameshift_variant Average:7.341; most accessible tissue: Callus, score: 21.426 N N N N
vg0501528934 T -> C LOC_Os05g03600.1 synonymous_variant ; p.Cys1447Cys; LOW synonymous_codon Average:7.341; most accessible tissue: Callus, score: 21.426 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501528934 NA 4.03E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 1.85E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 4.19E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 5.22E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 2.23E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 9.29E-06 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 7.11E-07 1.32E-15 mr1486 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 9.76E-09 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 7.78E-10 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 7.33E-10 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 1.65E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 1.60E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 1.77E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 2.91E-08 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 6.10E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 5.57E-11 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 4.87E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 2.69E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 1.21E-12 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 4.04E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 9.43E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934 NA 4.92E-08 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251