Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0300718648:

Variant ID: vg0300718648 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 718648
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, T: 0.10, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TAACCACGATATTAAATGTGAATATTCCAGTCCAACTCCGATACCCGAGAGTAAAGAGCTATCTCTGCAGTCTAAGATTCTCCCTGAATCTTCTTCTGAT[A/T]
ACCAAGATATTAAGTGTGAAGATCCTAGCCCAACTCCGATATCTAAGAGTAAAGAGGTGTCTCCGCAATCTAAGATTCTCTCTGAATCTTATCTTGATAA

Reverse complement sequence

TTATCAAGATAAGATTCAGAGAGAATCTTAGATTGCGGAGACACCTCTTTACTCTTAGATATCGGAGTTGGGCTAGGATCTTCACACTTAATATCTTGGT[T/A]
ATCAGAAGAAGATTCAGGGAGAATCTTAGACTGCAGAGATAGCTCTTTACTCTCGGGTATCGGAGTTGGACTGGAATATTCACATTTAATATCGTGGTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 42.50% 0.04% 0.00% NA
All Indica  2759 87.40% 12.60% 0.04% 0.00% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 84.80% 15.20% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 61.90% 37.80% 0.22% 0.00% NA
Indica III  913 96.60% 3.40% 0.00% 0.00% NA
Indica Intermediate  786 83.50% 16.50% 0.00% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 25.00% 74.00% 1.04% 0.00% NA
Intermediate  90 45.60% 54.40% 0.00% 0.00% NA

QTN in RiceNavi

Rice quantitative trait nucleotides (QTNs) and inferred QTN effects are from Wei et al., Nature Genetics, 2021.

CategoryVariant IDChromPosGeneMSURAPAlt_Allele_FunctionRef_genoAlt_geno
Heading datevg0300718648Chr3718648Ehd4LOC_Os03g02160Os03g0112700delaying heading dateAT

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0300718648 A -> T LOC_Os03g02160.3 missense_variant ; p.Asn384Tyr; MODERATE nonsynonymous_codon Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 benign 0.04 DELETERIOUS 0.04
vg0300718648 A -> T LOC_Os03g02160.1 missense_variant ; p.Asn384Tyr; MODERATE nonsynonymous_codon Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 benign 0.04 DELETERIOUS 0.04
vg0300718648 A -> T LOC_Os03g02160.2 missense_variant ; p.Asn384Tyr; MODERATE nonsynonymous_codon Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 benign 0.04 DELETERIOUS 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0300718648 NA 1.45E-28 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 5.41E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 1.31E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 5.75E-21 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 2.00E-10 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 1.22E-07 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 3.15E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 6.24E-06 mr1607 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 1.19E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 8.51E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 7.84E-08 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 2.61E-11 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 1.65E-07 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 6.20E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 2.08E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 6.45E-11 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 6.53E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 6.96E-15 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 5.15E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 1.91E-08 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 3.44E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 8.15E-07 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 1.41E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 8.81E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 3.53E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 4.46E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300718648 NA 2.19E-07 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251