\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220874786:

Variant ID: vg1220874786 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20874786
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.24, others allele: 0.00, population size: 42. )

Flanking Sequence (100 bp) in Reference Genome:


TTAATCACGGCTCACAGCCATAAGCACAAAATCACAAATTGTACTGCGAGGGCACGCCATGCGGCGACGGGACACCGCCGGACTGGGCGCACGAGATGCT[G/A]
CTCGAGCACGACGCGGCGCGCCGCTTCTTCCGCTACGAGATGAATGGCAACAGTATGGGCTTCGGCGTCTTCTTCGCCATGTTCCGCGTCATCGTCGTCG

Reverse complement sequence

CGACGACGATGACGCGGAACATGGCGAAGAAGACGCCGAAGCCCATACTGTTGCCATTCATCTCGTAGCGGAAGAAGCGGCGCGCCGCGTCGTGCTCGAG[C/T]
AGCATCTCGTGCGCCCAGTCCGGCGGTGTCCCGTCGCCGCATGGCGTGCCCTCGCAGTACAATTTGTGATTTTGTGCTTATGGCTGTGAGCCGTGATTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.00% 19.90% 3.43% 51.69% NA
All Indica  2759 37.80% 2.80% 4.75% 54.73% NA
All Japonica  1512 1.30% 44.20% 0.79% 53.70% NA
Aus  269 5.20% 62.80% 4.83% 27.14% NA
Indica I  595 29.90% 1.50% 3.36% 65.21% NA
Indica II  465 40.00% 4.90% 6.02% 49.03% NA
Indica III  913 39.00% 1.30% 3.94% 55.75% NA
Indica Intermediate  786 41.00% 4.10% 5.98% 48.98% NA
Temperate Japonica  767 0.50% 74.20% 0.26% 25.03% NA
Tropical Japonica  504 1.80% 3.00% 0.99% 94.25% NA
Japonica Intermediate  241 2.50% 35.30% 2.07% 60.17% NA
VI/Aromatic  96 84.40% 2.10% 1.04% 12.50% NA
Intermediate  90 28.90% 25.60% 5.56% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220874786 G -> DEL N N silent_mutation Average:53.167; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg1220874786 G -> A LOC_Os12g34460.2 downstream_gene_variant ; 3765.0bp to feature; MODIFIER silent_mutation Average:53.167; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg1220874786 G -> A LOC_Os12g34470.1 downstream_gene_variant ; 78.0bp to feature; MODIFIER silent_mutation Average:53.167; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg1220874786 G -> A LOC_Os12g34480.1 downstream_gene_variant ; 2066.0bp to feature; MODIFIER silent_mutation Average:53.167; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg1220874786 G -> A LOC_Os12g34490.1 downstream_gene_variant ; 4774.0bp to feature; MODIFIER silent_mutation Average:53.167; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg1220874786 G -> A LOC_Os12g34470-LOC_Os12g34480 intergenic_region ; MODIFIER silent_mutation Average:53.167; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220874786 NA 2.28E-13 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1220874786 NA 1.77E-15 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 8.51E-14 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 3.56E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 5.32E-14 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 6.76E-44 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 7.23E-42 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 1.12E-11 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 2.09E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 8.84E-34 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 5.67E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 1.15E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 9.59E-11 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 1.89E-27 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 1.06E-10 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 5.70E-18 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 1.60E-31 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 5.12E-07 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 8.45E-22 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 1.10E-09 2.03E-25 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 5.63E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 4.89E-41 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 3.38E-12 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 3.01E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 9.06E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 1.39E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 7.42E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 3.76E-08 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 5.13E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 4.64E-11 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 5.13E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 1.50E-33 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 6.21E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 6.51E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 1.04E-09 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 3.48E-24 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 1.10E-07 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 2.74E-12 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 2.97E-25 4.57E-98 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 3.18E-09 1.06E-30 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 2.62E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 6.96E-28 mr1401_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 1.07E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 1.07E-15 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 NA 7.62E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 1.78E-07 NA mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220874786 9.28E-06 1.09E-12 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251