\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220853596:

Variant ID: vg1220853596 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20853596
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTCCACAATTTTTTGTTTTTACTCTTGTGCCACATAAGCGACACGTCGACGACACATGGGACGAAGACCGGGTCAATACCGTCACATGGGCACCACGTC[A/G]
GTCAAAACCGCTTCCAAAACCACTCAGGGATATAGTTTGCATTGGTTTTGATAGTTGGAGGAGTTGATATGTCCGGTTTTGTGGTTAGAGGTCATGAATC

Reverse complement sequence

GATTCATGACCTCTAACCACAAAACCGGACATATCAACTCCTCCAACTATCAAAACCAATGCAAACTATATCCCTGAGTGGTTTTGGAAGCGGTTTTGAC[T/C]
GACGTGGTGCCCATGTGACGGTATTGACCCGGTCTTCGTCCCATGTGTCGTCGACGTGTCGCTTATGTGGCACAAGAGTAAAAACAAAAAATTGTGGAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.80% 13.40% 0.06% 2.75% NA
All Indica  2759 97.20% 0.80% 0.04% 1.96% NA
All Japonica  1512 62.40% 37.60% 0.07% 0.00% NA
Aus  269 63.60% 9.30% 0.37% 26.77% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 96.30% 2.80% 0.22% 0.65% NA
Indica III  913 96.90% 0.10% 0.00% 2.96% NA
Indica Intermediate  786 96.40% 0.50% 0.00% 3.05% NA
Temperate Japonica  767 30.60% 69.20% 0.13% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 87.10% 12.90% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220853596 A -> DEL N N silent_mutation Average:66.359; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg1220853596 A -> G LOC_Os12g34390.1 upstream_gene_variant ; 3758.0bp to feature; MODIFIER silent_mutation Average:66.359; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg1220853596 A -> G LOC_Os12g34400.1 downstream_gene_variant ; 2338.0bp to feature; MODIFIER silent_mutation Average:66.359; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg1220853596 A -> G LOC_Os12g34419.1 downstream_gene_variant ; 2763.0bp to feature; MODIFIER silent_mutation Average:66.359; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg1220853596 A -> G LOC_Os12g34430.1 downstream_gene_variant ; 4589.0bp to feature; MODIFIER silent_mutation Average:66.359; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg1220853596 A -> G LOC_Os12g34410.1 intron_variant ; MODIFIER silent_mutation Average:66.359; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220853596 NA 7.98E-14 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1220853596 NA 5.45E-06 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 NA 4.45E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 3.56E-08 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 NA 7.41E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 1.54E-06 1.18E-08 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 NA 8.00E-10 mr1057_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 NA 1.32E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 NA 1.95E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 NA 1.90E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 3.31E-06 NA mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 NA 3.22E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 1.30E-06 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 NA 4.47E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 NA 8.61E-10 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 NA 5.12E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 NA 1.54E-10 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 NA 1.64E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 NA 6.90E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 NA 6.14E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 NA 4.88E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 NA 4.45E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 7.74E-08 4.12E-20 mr1980_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596 5.10E-06 1.00E-08 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251