Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220853596:

Variant ID: vg1220853596 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20853596
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTCCACAATTTTTTGTTTTTACTCTTGTGCCACATAAGCGACACGTCGACGACACATGGGACGAAGACCGGGTCAATACCGTCACATGGGCACCACGTC[A/G]
GTCAAAACCGCTTCCAAAACCACTCAGGGATATAGTTTGCATTGGTTTTGATAGTTGGAGGAGTTGATATGTCCGGTTTTGTGGTTAGAGGTCATGAATC

Reverse complement sequence

GATTCATGACCTCTAACCACAAAACCGGACATATCAACTCCTCCAACTATCAAAACCAATGCAAACTATATCCCTGAGTGGTTTTGGAAGCGGTTTTGAC[T/C]
GACGTGGTGCCCATGTGACGGTATTGACCCGGTCTTCGTCCCATGTGTCGTCGACGTGTCGCTTATGTGGCACAAGAGTAAAAACAAAAAATTGTGGAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.80%	13.40%	0.06%	2.75%	NA
All Indica	2759	97.20%	0.80%	0.04%	1.96%	NA
All Japonica	1512	62.40%	37.60%	0.07%	0.00%	NA
Aus	269	63.60%	9.30%	0.37%	26.77%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	96.30%	2.80%	0.22%	0.65%	NA
Indica III	913	96.90%	0.10%	0.00%	2.96%	NA
Indica Intermediate	786	96.40%	0.50%	0.00%	3.05%	NA
Temperate Japonica	767	30.60%	69.20%	0.13%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	87.10%	12.90%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	0.00%	0.00%	4.17%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220853596	A -> DEL	N	N	silent_mutation	Average:66.359; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg1220853596	A -> G	LOC_Os12g34390.1	upstream_gene_variant ; 3758.0bp to feature; MODIFIER	silent_mutation	Average:66.359; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg1220853596	A -> G	LOC_Os12g34400.1	downstream_gene_variant ; 2338.0bp to feature; MODIFIER	silent_mutation	Average:66.359; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg1220853596	A -> G	LOC_Os12g34419.1	downstream_gene_variant ; 2763.0bp to feature; MODIFIER	silent_mutation	Average:66.359; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg1220853596	A -> G	LOC_Os12g34430.1	downstream_gene_variant ; 4589.0bp to feature; MODIFIER	silent_mutation	Average:66.359; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg1220853596	A -> G	LOC_Os12g34410.1	intron_variant ; MODIFIER	silent_mutation	Average:66.359; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220853596	NA	7.98E-14	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1220853596	NA	5.45E-06	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	NA	4.45E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	3.56E-08	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	NA	7.41E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	1.54E-06	1.18E-08	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	NA	8.00E-10	mr1057_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	NA	1.32E-13	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	NA	1.95E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	NA	1.90E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	3.31E-06	NA	mr1261_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	NA	3.22E-10	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	1.30E-06	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	NA	4.47E-06	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	NA	8.61E-10	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	NA	5.12E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	NA	1.54E-10	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	NA	1.64E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	NA	6.90E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	NA	6.14E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	NA	4.88E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	NA	4.45E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	7.74E-08	4.12E-20	mr1980_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220853596	5.10E-06	1.00E-08	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251