\
| Variant ID: vg1217929894 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17929894 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 191. )
GCTTAGGGTCTTAGCATTTCTGGTAAAAAAAGCTCTTCTGTAATAATAATTTAAATTTCATACCTTGCATTTCATCACAATACATTCATTTTGCAAAACA[T/C]
GTAGCACTGAAAAATAATTTATAGTTGCAAATTTGTTCCTGCTCAAATATCGTTATGTGGTTTTTACATAGCAAGATGTTGGTCAAATGTTCGGAAGTAA
TTACTTCCGAACATTTGACCAACATCTTGCTATGTAAAAACCACATAACGATATTTGAGCAGGAACAAATTTGCAACTATAAATTATTTTTCAGTGCTAC[A/G]
TGTTTTGCAAAATGAATGTATTGTGATGAAATGCAAGGTATGAAATTTAAATTATTATTACAGAAGAGCTTTTTTTACCAGAAATGCTAAGACCCTAAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.50% | 35.30% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 75.80% | 23.90% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 46.30% | 53.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 62.50% | 37.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 56.10% | 43.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 80.40% | 19.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.70% | 16.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 78.90% | 20.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 73.80% | 26.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.40% | 33.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 37.50% | 60.40% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 44.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217929894 | T -> C | LOC_Os12g29990.1 | intron_variant ; MODIFIER | silent_mutation | Average:28.041; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1217929894 | T -> C | LOC_Os12g29990.4 | intron_variant ; MODIFIER | silent_mutation | Average:28.041; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1217929894 | T -> C | LOC_Os12g29990.2 | intron_variant ; MODIFIER | silent_mutation | Average:28.041; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217929894 | NA | 3.28E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1217929894 | NA | 3.41E-06 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 3.11E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 3.77E-07 | mr1280 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 3.64E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 3.29E-06 | mr1289 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 4.52E-06 | mr1318 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 4.17E-08 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 8.14E-06 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 2.04E-09 | mr1546 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 9.44E-06 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 6.49E-07 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 8.46E-06 | mr1580 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 1.08E-07 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 1.02E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 4.90E-06 | mr1587 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 2.46E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 6.97E-06 | mr1775 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | 2.27E-06 | 6.06E-09 | mr1788 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 1.79E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 2.04E-06 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 5.83E-08 | mr1093_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 8.98E-07 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 2.05E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 2.10E-07 | mr1227_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | 1.00E-06 | 2.78E-10 | mr1235_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 6.07E-06 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 6.16E-07 | mr1251_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 9.90E-06 | mr1377_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 7.50E-06 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 1.63E-06 | mr1423_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 5.25E-07 | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 1.29E-07 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 3.48E-10 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 1.96E-09 | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 6.60E-06 | mr1844_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 6.17E-07 | mr1849_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 3.01E-08 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217929894 | NA | 7.75E-07 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |