\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217574896:

Variant ID: vg1217574896 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17574896
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, A: 0.24, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGGCAGGCGCAATATCACTGTCACTAACTCAATTAAAAACTTTGCTCTATCGTGTATAGGATTATGGATTCTACTACAACAATGAGAGACAAATGGAA[T/A]
AGCATCGCTTCCAAACTGAAAACAGAATTGCTTAAGTATACAATTTGCCAGTTATCACAAACCTTGGCTTGTAGTACACAGTGAACATGGTTCCAGTGTT

Reverse complement sequence

AACACTGGAACCATGTTCACTGTGTACTACAAGCCAAGGTTTGTGATAACTGGCAAATTGTATACTTAAGCAATTCTGTTTTCAGTTTGGAAGCGATGCT[A/T]
TTCCATTTGTCTCTCATTGTTGTAGTAGAATCCATAATCCTATACACGATAGAGCAAAGTTTTTAATTGAGTTAGTGACAGTGATATTGCGCCTGCCAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.10% 25.80% 0.17% 0.00% NA
All Indica  2759 77.50% 22.30% 0.25% 0.00% NA
All Japonica  1512 68.80% 31.10% 0.07% 0.00% NA
Aus  269 63.20% 36.80% 0.00% 0.00% NA
Indica I  595 74.50% 25.40% 0.17% 0.00% NA
Indica II  465 85.60% 14.40% 0.00% 0.00% NA
Indica III  913 81.50% 18.40% 0.11% 0.00% NA
Indica Intermediate  786 70.40% 29.00% 0.64% 0.00% NA
Temperate Japonica  767 93.10% 6.80% 0.13% 0.00% NA
Tropical Japonica  504 43.70% 56.30% 0.00% 0.00% NA
Japonica Intermediate  241 44.40% 55.60% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217574896 T -> A LOC_Os12g29520.1 intron_variant ; MODIFIER silent_mutation Average:58.218; most accessible tissue: Zhenshan97 young leaf, score: 78.938 N N N N
vg1217574896 T -> A LOC_Os12g29520.2 intron_variant ; MODIFIER silent_mutation Average:58.218; most accessible tissue: Zhenshan97 young leaf, score: 78.938 N N N N
vg1217574896 T -> A LOC_Os12g29520.3 intron_variant ; MODIFIER silent_mutation Average:58.218; most accessible tissue: Zhenshan97 young leaf, score: 78.938 N N N N
vg1217574896 T -> A LOC_Os12g29520.4 intron_variant ; MODIFIER silent_mutation Average:58.218; most accessible tissue: Zhenshan97 young leaf, score: 78.938 N N N N
vg1217574896 T -> A LOC_Os12g29520.5 intron_variant ; MODIFIER silent_mutation Average:58.218; most accessible tissue: Zhenshan97 young leaf, score: 78.938 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217574896 NA 1.48E-09 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217574896 NA 8.36E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217574896 NA 2.63E-08 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217574896 NA 2.86E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217574896 6.53E-07 3.78E-08 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217574896 NA 1.27E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217574896 2.68E-06 2.78E-12 mr1627 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217574896 NA 8.11E-07 mr1653 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217574896 NA 1.78E-06 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217574896 NA 1.12E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217574896 NA 8.11E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217574896 NA 9.54E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217574896 NA 8.50E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217574896 NA 3.54E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217574896 NA 3.35E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251