\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217535382:

Variant ID: vg1217535382 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17535382
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.08, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


CGTAAAGTCAAGTCGACTTATCATTTTATTTTCTTTTTCAGGAGAGTTTCTTGTGCTATATATTCAATTTTGTCCATAGTACAATTGAAAAGGTAGTTAG[T/A]
TTTCTGTTCCAGCAAAATACTTCTTTTTTTTTTGCGATCGAATCCCATGTCTTGTAAGTTGTATACGACATTTAATTAGTTTTTGTCCTTTTGCAATTGG

Reverse complement sequence

CCAATTGCAAAAGGACAAAAACTAATTAAATGTCGTATACAACTTACAAGACATGGGATTCGATCGCAAAAAAAAAAGAAGTATTTTGCTGGAACAGAAA[A/T]
CTAACTACCTTTTCAATTGTACTATGGACAAAATTGAATATATAGCACAAGAAACTCTCCTGAAAAAGAAAATAAAATGATAAGTCGACTTGACTTTACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 42.40% 0.47% 0.85% NA
All Indica  2759 64.40% 33.60% 0.62% 1.34% NA
All Japonica  1512 48.50% 51.30% 0.00% 0.20% NA
Aus  269 27.10% 72.90% 0.00% 0.00% NA
Indica I  595 74.60% 18.30% 1.18% 5.88% NA
Indica II  465 87.50% 12.30% 0.22% 0.00% NA
Indica III  913 43.20% 56.30% 0.44% 0.11% NA
Indica Intermediate  786 67.80% 31.40% 0.64% 0.13% NA
Temperate Japonica  767 9.90% 89.70% 0.00% 0.39% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 66.40% 33.60% 0.00% 0.00% NA
VI/Aromatic  96 35.40% 64.60% 0.00% 0.00% NA
Intermediate  90 45.60% 48.90% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217535382 T -> DEL N N silent_mutation Average:47.71; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg1217535382 T -> A LOC_Os12g29500.1 downstream_gene_variant ; 1926.0bp to feature; MODIFIER silent_mutation Average:47.71; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg1217535382 T -> A LOC_Os12g29480-LOC_Os12g29500 intergenic_region ; MODIFIER silent_mutation Average:47.71; most accessible tissue: Minghui63 root, score: 69.344 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217535382 NA 4.71E-15 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217535382 NA 2.86E-08 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 2.37E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 6.50E-07 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 4.14E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 2.16E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 1.21E-13 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 1.27E-10 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 1.92E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 2.86E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 4.00E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 5.84E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 1.61E-07 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 5.81E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 2.47E-09 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 3.99E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 8.06E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 1.30E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 7.82E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 7.28E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 5.88E-06 mr1388_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 6.90E-09 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 1.46E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 2.84E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 1.66E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 2.56E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 1.79E-11 mr1582_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 2.79E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 3.81E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 4.52E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217535382 NA 4.21E-11 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251