\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216471043:

Variant ID: vg1216471043 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16471043
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, G: 0.15, others allele: 0.00, population size: 34. )

Flanking Sequence (100 bp) in Reference Genome:


CGAAGCTCGATCGAGCTCGAACTTAAGATCGATCAGTATCCAGGCTCAGCTCGAGCTTGGCTCAATTTCATGTCAAGCTCAAGCCTACATAGCCAAACTC[T/G]
CTCGAGCTCGGCTCGTTAACAGCCCTACTCCCAGCGCACTCCCCTCTTATTATCTCCCGAGCCCGGCACGAGTGGTTGGTGGTGTCTCATACACGCGCGA

Reverse complement sequence

TCGCGCGTGTATGAGACACCACCAACCACTCGTGCCGGGCTCGGGAGATAATAAGAGGGGAGTGCGCTGGGAGTAGGGCTGTTAACGAGCCGAGCTCGAG[A/C]
GAGTTTGGCTATGTAGGCTTGAGCTTGACATGAAATTGAGCCAAGCTCGAGCTGAGCCTGGATACTGATCGATCTTAAGTTCGAGCTCGATCGAGCTTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.30% 17.80% 0.68% 56.26% NA
All Indica  2759 25.90% 3.00% 1.09% 70.03% NA
All Japonica  1512 18.60% 48.50% 0.07% 32.80% NA
Aus  269 53.50% 0.70% 0.00% 45.72% NA
Indica I  595 3.40% 3.00% 1.85% 91.76% NA
Indica II  465 67.30% 5.20% 0.43% 27.10% NA
Indica III  913 13.00% 0.50% 1.42% 84.99% NA
Indica Intermediate  786 33.30% 4.60% 0.51% 61.58% NA
Temperate Japonica  767 0.90% 79.10% 0.00% 19.95% NA
Tropical Japonica  504 50.60% 4.40% 0.00% 45.04% NA
Japonica Intermediate  241 7.90% 43.60% 0.41% 48.13% NA
VI/Aromatic  96 27.10% 1.00% 0.00% 71.88% NA
Intermediate  90 32.20% 23.30% 1.11% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216471043 T -> DEL N N silent_mutation Average:52.757; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1216471043 T -> G LOC_Os12g27940.1 downstream_gene_variant ; 1110.0bp to feature; MODIFIER silent_mutation Average:52.757; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1216471043 T -> G LOC_Os12g27940-LOC_Os12g27950 intergenic_region ; MODIFIER silent_mutation Average:52.757; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216471043 NA 1.59E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 1.77E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 4.06E-06 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 4.27E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 1.87E-09 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 2.34E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 2.53E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 1.33E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 1.50E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 9.82E-06 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 1.65E-07 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 2.85E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 9.36E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 1.89E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 4.29E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 2.45E-06 mr1698 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 8.07E-08 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 4.25E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 3.25E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 4.81E-07 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 8.94E-08 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 7.98E-06 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 7.02E-07 1.44E-08 mr1990 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 8.42E-10 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 1.20E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 1.50E-06 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 6.12E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043 NA 7.51E-08 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251