Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216471043:

Variant ID: vg1216471043 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16471043
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, G: 0.15, others allele: 0.00, population size: 34. )

Flanking Sequence (100 bp) in Reference Genome:

CGAAGCTCGATCGAGCTCGAACTTAAGATCGATCAGTATCCAGGCTCAGCTCGAGCTTGGCTCAATTTCATGTCAAGCTCAAGCCTACATAGCCAAACTC[T/G]
CTCGAGCTCGGCTCGTTAACAGCCCTACTCCCAGCGCACTCCCCTCTTATTATCTCCCGAGCCCGGCACGAGTGGTTGGTGGTGTCTCATACACGCGCGA

Reverse complement sequence

TCGCGCGTGTATGAGACACCACCAACCACTCGTGCCGGGCTCGGGAGATAATAAGAGGGGAGTGCGCTGGGAGTAGGGCTGTTAACGAGCCGAGCTCGAG[A/C]
GAGTTTGGCTATGTAGGCTTGAGCTTGACATGAAATTGAGCCAAGCTCGAGCTGAGCCTGGATACTGATCGATCTTAAGTTCGAGCTCGATCGAGCTTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.30%	17.80%	0.68%	56.26%	NA
All Indica	2759	25.90%	3.00%	1.09%	70.03%	NA
All Japonica	1512	18.60%	48.50%	0.07%	32.80%	NA
Aus	269	53.50%	0.70%	0.00%	45.72%	NA
Indica I	595	3.40%	3.00%	1.85%	91.76%	NA
Indica II	465	67.30%	5.20%	0.43%	27.10%	NA
Indica III	913	13.00%	0.50%	1.42%	84.99%	NA
Indica Intermediate	786	33.30%	4.60%	0.51%	61.58%	NA
Temperate Japonica	767	0.90%	79.10%	0.00%	19.95%	NA
Tropical Japonica	504	50.60%	4.40%	0.00%	45.04%	NA
Japonica Intermediate	241	7.90%	43.60%	0.41%	48.13%	NA
VI/Aromatic	96	27.10%	1.00%	0.00%	71.88%	NA
Intermediate	90	32.20%	23.30%	1.11%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216471043	T -> DEL	N	N	silent_mutation	Average:52.757; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg1216471043	T -> G	LOC_Os12g27940.1	downstream_gene_variant ; 1110.0bp to feature; MODIFIER	silent_mutation	Average:52.757; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg1216471043	T -> G	LOC_Os12g27940-LOC_Os12g27950	intergenic_region ; MODIFIER	silent_mutation	Average:52.757; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216471043	NA	1.59E-07	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	1.77E-06	mr1042	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	4.06E-06	mr1043	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	4.27E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	1.87E-09	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	2.34E-07	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	2.53E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	1.33E-07	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	1.50E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	9.82E-06	mr1479	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	1.65E-07	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	2.85E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	9.36E-09	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	1.89E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	4.29E-09	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	2.45E-06	mr1698	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	8.07E-08	mr1725	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	4.25E-07	mr1726	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	3.25E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	4.81E-07	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	8.94E-08	mr1912	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	7.98E-06	mr1912	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	7.02E-07	1.44E-08	mr1990	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	8.42E-10	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	1.20E-06	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	1.50E-06	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	6.12E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471043	NA	7.51E-08	mr1892_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251