\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208659303:

Variant ID: vg1208659303 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8659303
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.35, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


GTTATTAACAAAATCGGTAGCGCTGCAGCGGTCATGATCACCTGAGATGCCTCAGACATGACGCTTTGTTACACATGCGAAAGGAAAAGGTGTAGACGTG[T/C]
ATTATGCAGCGGGCCAAAAAGAGAACTTTAGACACTTTAGTTATTAATAATAGATCCGATGATTTAAATAATGGGTCGTACTTGTTCTAGTGTAAATGTA

Reverse complement sequence

TACATTTACACTAGAACAAGTACGACCCATTATTTAAATCATCGGATCTATTATTAATAACTAAAGTGTCTAAAGTTCTCTTTTTGGCCCGCTGCATAAT[A/G]
CACGTCTACACCTTTTCCTTTCGCATGTGTAACAAAGCGTCATGTCTGAGGCATCTCAGGTGATCATGACCGCTGCAGCGCTACCGATTTTGTTAATAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.90% 25.90% 7.53% 26.70% NA
All Indica  2759 36.40% 12.90% 9.39% 41.32% NA
All Japonica  1512 50.30% 46.00% 1.52% 2.18% NA
Aus  269 18.20% 29.70% 23.79% 28.25% NA
Indica I  595 63.70% 2.00% 4.03% 30.25% NA
Indica II  465 28.20% 37.20% 12.69% 21.94% NA
Indica III  913 18.90% 6.20% 10.19% 64.62% NA
Indica Intermediate  786 41.00% 14.40% 10.56% 34.10% NA
Temperate Japonica  767 76.50% 18.80% 1.30% 3.39% NA
Tropical Japonica  504 17.10% 80.60% 1.39% 0.99% NA
Japonica Intermediate  241 36.10% 60.60% 2.49% 0.83% NA
VI/Aromatic  96 28.10% 62.50% 4.17% 5.21% NA
Intermediate  90 47.80% 36.70% 6.67% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208659303 T -> C LOC_Os12g15190.1 downstream_gene_variant ; 2705.0bp to feature; MODIFIER silent_mutation Average:8.4; most accessible tissue: Callus, score: 40.438 N N N N
vg1208659303 T -> C LOC_Os12g15180-LOC_Os12g15190 intergenic_region ; MODIFIER silent_mutation Average:8.4; most accessible tissue: Callus, score: 40.438 N N N N
vg1208659303 T -> DEL N N silent_mutation Average:8.4; most accessible tissue: Callus, score: 40.438 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208659303 NA 1.53E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208659303 NA 5.13E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208659303 NA 7.45E-10 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 9.70E-06 2.15E-13 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 NA 1.09E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 NA 1.25E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 NA 2.38E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 NA 4.44E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 NA 4.76E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 NA 5.02E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 3.07E-06 2.19E-12 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 6.58E-08 1.54E-19 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 NA 9.22E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 NA 1.07E-14 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 NA 7.00E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 8.12E-06 4.91E-19 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 NA 3.22E-10 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 NA 2.28E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 7.65E-07 5.09E-21 mr1031_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 NA 1.71E-12 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 NA 4.22E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 NA 2.75E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208659303 NA 1.70E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251