\
| Variant ID: vg1208659303 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8659303 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.35, others allele: 0.00, population size: 74. )
GTTATTAACAAAATCGGTAGCGCTGCAGCGGTCATGATCACCTGAGATGCCTCAGACATGACGCTTTGTTACACATGCGAAAGGAAAAGGTGTAGACGTG[T/C]
ATTATGCAGCGGGCCAAAAAGAGAACTTTAGACACTTTAGTTATTAATAATAGATCCGATGATTTAAATAATGGGTCGTACTTGTTCTAGTGTAAATGTA
TACATTTACACTAGAACAAGTACGACCCATTATTTAAATCATCGGATCTATTATTAATAACTAAAGTGTCTAAAGTTCTCTTTTTGGCCCGCTGCATAAT[A/G]
CACGTCTACACCTTTTCCTTTCGCATGTGTAACAAAGCGTCATGTCTGAGGCATCTCAGGTGATCATGACCGCTGCAGCGCTACCGATTTTGTTAATAAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.90% | 25.90% | 7.53% | 26.70% | NA |
| All Indica | 2759 | 36.40% | 12.90% | 9.39% | 41.32% | NA |
| All Japonica | 1512 | 50.30% | 46.00% | 1.52% | 2.18% | NA |
| Aus | 269 | 18.20% | 29.70% | 23.79% | 28.25% | NA |
| Indica I | 595 | 63.70% | 2.00% | 4.03% | 30.25% | NA |
| Indica II | 465 | 28.20% | 37.20% | 12.69% | 21.94% | NA |
| Indica III | 913 | 18.90% | 6.20% | 10.19% | 64.62% | NA |
| Indica Intermediate | 786 | 41.00% | 14.40% | 10.56% | 34.10% | NA |
| Temperate Japonica | 767 | 76.50% | 18.80% | 1.30% | 3.39% | NA |
| Tropical Japonica | 504 | 17.10% | 80.60% | 1.39% | 0.99% | NA |
| Japonica Intermediate | 241 | 36.10% | 60.60% | 2.49% | 0.83% | NA |
| VI/Aromatic | 96 | 28.10% | 62.50% | 4.17% | 5.21% | NA |
| Intermediate | 90 | 47.80% | 36.70% | 6.67% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208659303 | T -> C | LOC_Os12g15190.1 | downstream_gene_variant ; 2705.0bp to feature; MODIFIER | silent_mutation | Average:8.4; most accessible tissue: Callus, score: 40.438 | N | N | N | N |
| vg1208659303 | T -> C | LOC_Os12g15180-LOC_Os12g15190 | intergenic_region ; MODIFIER | silent_mutation | Average:8.4; most accessible tissue: Callus, score: 40.438 | N | N | N | N |
| vg1208659303 | T -> DEL | N | N | silent_mutation | Average:8.4; most accessible tissue: Callus, score: 40.438 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208659303 | NA | 1.53E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1208659303 | NA | 5.13E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1208659303 | NA | 7.45E-10 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | 9.70E-06 | 2.15E-13 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | NA | 1.09E-06 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | NA | 1.25E-13 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | NA | 2.38E-08 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | NA | 4.44E-13 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | NA | 4.76E-07 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | NA | 5.02E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | 3.07E-06 | 2.19E-12 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | 6.58E-08 | 1.54E-19 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | NA | 9.22E-09 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | NA | 1.07E-14 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | NA | 7.00E-09 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | 8.12E-06 | 4.91E-19 | mr1013_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | NA | 3.22E-10 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | NA | 2.28E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | 7.65E-07 | 5.09E-21 | mr1031_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | NA | 1.71E-12 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | NA | 4.22E-06 | mr1268_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | NA | 2.75E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208659303 | NA | 1.70E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |