\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208472138:

Variant ID: vg1208472138 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8472138
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TGACCAAGATATGATCATCCGAAGTTTAATGCTGTTATATGGAGATTTGCGGATTATTATAATTAAGCTTTGCAACTATAAAACAGGTGTAAGCGCTAGC[T/C]
TGGAAAAGACAGGAAGGCTGCGTCGTTGACATGCGGACCCCACATGTCAACAAAAAGGACCGCGGTAGACCGAGTACACAGAGACGGTCCACGGGTCGAC

Reverse complement sequence

GTCGACCCGTGGACCGTCTCTGTGTACTCGGTCTACCGCGGTCCTTTTTGTTGACATGTGGGGTCCGCATGTCAACGACGCAGCCTTCCTGTCTTTTCCA[A/G]
GCTAGCGCTTACACCTGTTTTATAGTTGCAAAGCTTAATTATAATAATCCGCAAATCTCCATATAACAGCATTAAACTTCGGATGATCATATCTTGGTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.50% 18.20% 20.55% 31.72% NA
All Indica  2759 19.80% 1.00% 30.70% 48.46% NA
All Japonica  1512 42.70% 52.70% 1.39% 3.17% NA
Aus  269 41.60% 0.70% 29.00% 28.62% NA
Indica I  595 30.80% 1.00% 12.10% 56.13% NA
Indica II  465 18.70% 0.60% 26.67% 53.98% NA
Indica III  913 10.80% 0.70% 47.86% 40.64% NA
Indica Intermediate  786 22.60% 1.70% 27.23% 48.47% NA
Temperate Japonica  767 68.10% 26.50% 0.65% 4.82% NA
Tropical Japonica  504 11.30% 84.50% 2.18% 1.98% NA
Japonica Intermediate  241 27.80% 69.70% 2.07% 0.41% NA
VI/Aromatic  96 54.20% 7.30% 15.62% 22.92% NA
Intermediate  90 43.30% 28.90% 11.11% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208472138 T -> C LOC_Os12g14820.1 upstream_gene_variant ; 4896.0bp to feature; MODIFIER silent_mutation Average:14.885; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1208472138 T -> C LOC_Os12g14800.1 downstream_gene_variant ; 1868.0bp to feature; MODIFIER silent_mutation Average:14.885; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1208472138 T -> C LOC_Os12g14800-LOC_Os12g14820 intergenic_region ; MODIFIER silent_mutation Average:14.885; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1208472138 T -> DEL N N silent_mutation Average:14.885; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208472138 NA 5.45E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208472138 NA 1.27E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208472138 5.84E-08 2.61E-14 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 5.54E-13 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 2.68E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 6.30E-08 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 2.88E-16 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 1.29E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 1.52E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 4.49E-16 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 2.40E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 6.91E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 6.64E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 1.55E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 1.53E-12 1.17E-21 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 1.04E-09 8.60E-21 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 4.75E-22 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 1.84E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 1.22E-13 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 1.21E-10 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 1.55E-06 5.52E-22 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 1.02E-11 mr1013_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 2.11E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 2.61E-06 1.18E-20 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 1.67E-06 5.17E-14 mr1031_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 4.97E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 4.62E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 9.18E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 5.62E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 1.52E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 4.03E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 7.32E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 4.14E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208472138 NA 3.74E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251