\
| Variant ID: vg1208322523 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8322523 |
| Reference Allele: A | Alternative Allele: T,C |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, A: 0.34, others allele: 0.00, population size: 96. )
CACGGCGAATAGACTCCAGGTGCTTGCAACGTCATTGGCTCATCTCCAGGTTCGTTCATATAATGCAGGTGGTTTGGAGTCTTATATCCCAAGTCTTCTT[A/T,C]
TTTTAAAGATGATGAAGAAGAAGAAGGCTTAATTAAGACCGCGCTGAAGAGACGATGTTAATTCCCACGGGCACGTATATTAGATATAGACTCTATTAGA
TCTAATAGAGTCTATATCTAATATACGTGCCCGTGGGAATTAACATCGTCTCTTCAGCGCGGTCTTAATTAAGCCTTCTTCTTCTTCATCATCTTTAAAA[T/A,G]
AAGAAGACTTGGGATATAAGACTCCAAACCACCTGCATTATATGAACGAACCTGGAGATGAGCCAATGACGTTGCAAGCACCTGGAGTCTATTCGCCGTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.70% | 27.60% | 0.44% | 17.20% | C: 0.04% |
| All Indica | 2759 | 60.60% | 15.30% | 0.58% | 23.49% | C: 0.04% |
| All Japonica | 1512 | 55.60% | 41.90% | 0.33% | 2.12% | C: 0.07% |
| Aus | 269 | 5.60% | 67.30% | 0.00% | 27.14% | NA |
| Indica I | 595 | 51.60% | 29.40% | 0.67% | 18.32% | NA |
| Indica II | 465 | 51.40% | 17.40% | 0.00% | 31.18% | NA |
| Indica III | 913 | 70.30% | 3.60% | 0.88% | 25.08% | C: 0.11% |
| Indica Intermediate | 786 | 61.50% | 17.00% | 0.51% | 20.99% | NA |
| Temperate Japonica | 767 | 29.30% | 66.50% | 0.52% | 3.65% | NA |
| Tropical Japonica | 504 | 87.90% | 11.10% | 0.20% | 0.60% | C: 0.20% |
| Japonica Intermediate | 241 | 71.40% | 28.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 14.60% | 34.40% | 0.00% | 51.04% | NA |
| Intermediate | 90 | 50.00% | 37.80% | 0.00% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208322523 | A -> C | LOC_Os12g14570.1 | downstream_gene_variant ; 4644.0bp to feature; MODIFIER | silent_mutation | Average:42.082; most accessible tissue: Callus, score: 95.103 | N | N | N | N |
| vg1208322523 | A -> C | LOC_Os12g14570-LOC_Os12g14580 | intergenic_region ; MODIFIER | silent_mutation | Average:42.082; most accessible tissue: Callus, score: 95.103 | N | N | N | N |
| vg1208322523 | A -> DEL | N | N | silent_mutation | Average:42.082; most accessible tissue: Callus, score: 95.103 | N | N | N | N |
| vg1208322523 | A -> T | LOC_Os12g14570.1 | downstream_gene_variant ; 4644.0bp to feature; MODIFIER | silent_mutation | Average:42.082; most accessible tissue: Callus, score: 95.103 | N | N | N | N |
| vg1208322523 | A -> T | LOC_Os12g14570-LOC_Os12g14580 | intergenic_region ; MODIFIER | silent_mutation | Average:42.082; most accessible tissue: Callus, score: 95.103 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208322523 | NA | 1.04E-09 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1208322523 | NA | 1.73E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1208322523 | NA | 3.43E-09 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | 9.27E-07 | 3.80E-14 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | NA | 5.16E-07 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | NA | 1.84E-12 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | NA | 7.79E-09 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | NA | 1.31E-12 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | NA | 8.97E-08 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | NA | 5.33E-06 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | 2.06E-07 | 2.85E-07 | mr1928 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | 7.02E-06 | 1.76E-14 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | 1.01E-10 | 9.41E-22 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | NA | 1.39E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | NA | 2.67E-10 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | NA | 2.86E-10 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | NA | 1.82E-09 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | NA | 1.44E-11 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | NA | 5.74E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | NA | 3.30E-08 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | NA | 8.12E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | NA | 2.37E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208322523 | NA | 2.83E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |