\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208322523:

Variant ID: vg1208322523 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8322523
Reference Allele: AAlternative Allele: T,C
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, A: 0.34, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


CACGGCGAATAGACTCCAGGTGCTTGCAACGTCATTGGCTCATCTCCAGGTTCGTTCATATAATGCAGGTGGTTTGGAGTCTTATATCCCAAGTCTTCTT[A/T,C]
TTTTAAAGATGATGAAGAAGAAGAAGGCTTAATTAAGACCGCGCTGAAGAGACGATGTTAATTCCCACGGGCACGTATATTAGATATAGACTCTATTAGA

Reverse complement sequence

TCTAATAGAGTCTATATCTAATATACGTGCCCGTGGGAATTAACATCGTCTCTTCAGCGCGGTCTTAATTAAGCCTTCTTCTTCTTCATCATCTTTAAAA[T/A,G]
AAGAAGACTTGGGATATAAGACTCCAAACCACCTGCATTATATGAACGAACCTGGAGATGAGCCAATGACGTTGCAAGCACCTGGAGTCTATTCGCCGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.70% 27.60% 0.44% 17.20% C: 0.04%
All Indica  2759 60.60% 15.30% 0.58% 23.49% C: 0.04%
All Japonica  1512 55.60% 41.90% 0.33% 2.12% C: 0.07%
Aus  269 5.60% 67.30% 0.00% 27.14% NA
Indica I  595 51.60% 29.40% 0.67% 18.32% NA
Indica II  465 51.40% 17.40% 0.00% 31.18% NA
Indica III  913 70.30% 3.60% 0.88% 25.08% C: 0.11%
Indica Intermediate  786 61.50% 17.00% 0.51% 20.99% NA
Temperate Japonica  767 29.30% 66.50% 0.52% 3.65% NA
Tropical Japonica  504 87.90% 11.10% 0.20% 0.60% C: 0.20%
Japonica Intermediate  241 71.40% 28.20% 0.00% 0.41% NA
VI/Aromatic  96 14.60% 34.40% 0.00% 51.04% NA
Intermediate  90 50.00% 37.80% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208322523 A -> C LOC_Os12g14570.1 downstream_gene_variant ; 4644.0bp to feature; MODIFIER silent_mutation Average:42.082; most accessible tissue: Callus, score: 95.103 N N N N
vg1208322523 A -> C LOC_Os12g14570-LOC_Os12g14580 intergenic_region ; MODIFIER silent_mutation Average:42.082; most accessible tissue: Callus, score: 95.103 N N N N
vg1208322523 A -> DEL N N silent_mutation Average:42.082; most accessible tissue: Callus, score: 95.103 N N N N
vg1208322523 A -> T LOC_Os12g14570.1 downstream_gene_variant ; 4644.0bp to feature; MODIFIER silent_mutation Average:42.082; most accessible tissue: Callus, score: 95.103 N N N N
vg1208322523 A -> T LOC_Os12g14570-LOC_Os12g14580 intergenic_region ; MODIFIER silent_mutation Average:42.082; most accessible tissue: Callus, score: 95.103 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208322523 NA 1.04E-09 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208322523 NA 1.73E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208322523 NA 3.43E-09 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 9.27E-07 3.80E-14 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 NA 5.16E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 NA 1.84E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 NA 7.79E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 NA 1.31E-12 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 NA 8.97E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 NA 5.33E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 2.06E-07 2.85E-07 mr1928 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 7.02E-06 1.76E-14 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 1.01E-10 9.41E-22 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 NA 1.39E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 NA 2.67E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 NA 2.86E-10 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 NA 1.82E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 NA 1.44E-11 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 NA 5.74E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 NA 3.30E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 NA 8.12E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 NA 2.37E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208322523 NA 2.83E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251