\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208320508:

Variant ID: vg1208320508 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8320508
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCAACCGTCAATGTGATGATTTGTTCTAGAGTTGTTTTCTTTAGGAACATTGGCATTGTTAATATTTTGCAAGCCATAACAAATGAAAAAAGATAAAG[A/G]
CTCACAAGGACTACCAGGCCCAAAGACCGTATCCTTGTCCCCTCGATCCATTGCCGCCCGCGCGCTACTTAGCCTCGATAGTTCGGTGTCGCGCAGGCAT

Reverse complement sequence

ATGCCTGCGCGACACCGAACTATCGAGGCTAAGTAGCGCGCGGGCGGCAATGGATCGAGGGGACAAGGATACGGTCTTTGGGCCTGGTAGTCCTTGTGAG[T/C]
CTTTATCTTTTTTCATTTGTTATGGCTTGCAAAATATTAACAATGCCAATGTTCCTAAAGAAAACAACTCTAGAACAAATCATCACATTGACGGTTGACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 20.70% 0.19% 14.88% NA
All Indica  2759 65.80% 10.60% 0.18% 23.41% NA
All Japonica  1512 56.30% 41.50% 0.26% 1.98% NA
Aus  269 98.10% 1.50% 0.00% 0.37% NA
Indica I  595 61.80% 19.50% 0.50% 18.15% NA
Indica II  465 53.30% 15.70% 0.22% 30.75% NA
Indica III  913 72.90% 1.50% 0.00% 25.52% NA
Indica Intermediate  786 67.80% 11.50% 0.13% 20.61% NA
Temperate Japonica  767 30.00% 66.10% 0.39% 3.52% NA
Tropical Japonica  504 88.50% 10.90% 0.00% 0.60% NA
Japonica Intermediate  241 72.60% 27.00% 0.41% 0.00% NA
VI/Aromatic  96 49.00% 27.10% 0.00% 23.96% NA
Intermediate  90 65.60% 31.10% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208320508 A -> DEL N N silent_mutation Average:25.315; most accessible tissue: Callus, score: 56.17 N N N N
vg1208320508 A -> G LOC_Os12g14570.1 downstream_gene_variant ; 2629.0bp to feature; MODIFIER silent_mutation Average:25.315; most accessible tissue: Callus, score: 56.17 N N N N
vg1208320508 A -> G LOC_Os12g14570-LOC_Os12g14580 intergenic_region ; MODIFIER silent_mutation Average:25.315; most accessible tissue: Callus, score: 56.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208320508 NA 3.31E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208320508 NA 1.73E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208320508 3.47E-07 2.10E-16 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 9.27E-07 3.80E-14 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 NA 5.16E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 NA 7.79E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 NA 8.97E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 1.29E-08 2.43E-22 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 1.01E-10 9.41E-22 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 NA 1.39E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 6.96E-07 9.85E-13 mr1011_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 NA 2.86E-10 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 NA 2.29E-15 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 NA 1.82E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 NA 8.34E-10 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 NA 5.65E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 NA 1.44E-11 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 NA 1.76E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 NA 5.74E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 NA 3.30E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208320508 NA 2.37E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251