\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208286528:

Variant ID: vg1208286528 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8286528
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, A: 0.29, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


TGACTTATCAAATAGTTATGGTCTAAAGGTAATTATTTGAGAAAACGTTTTTAAGATGTACTATGGGAAAAAAAATTACAGCTATATATTCACCCGCCCT[A/C]
TGTAACGTGGTACAAGTCCTTCACTACCACAATTAAATCCCAACTGGCACCATCAGATGGTGTATTTATTTTTAAAGAGTAGAGGCACATTTGAAACATA

Reverse complement sequence

TATGTTTCAAATGTGCCTCTACTCTTTAAAAATAAATACACCATCTGATGGTGCCAGTTGGGATTTAATTGTGGTAGTGAAGGACTTGTACCACGTTACA[T/G]
AGGGCGGGTGAATATATAGCTGTAATTTTTTTTCCCATAGTACATCTTAAAAACGTTTTCTCAAATAATTACCTTTAGACCATAACTATTTGATAAGTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.60% 17.30% 0.49% 26.58% NA
All Indica  2759 58.60% 4.00% 0.51% 36.90% NA
All Japonica  1512 55.30% 41.30% 0.07% 3.37% NA
Aus  269 32.70% 13.40% 2.97% 50.93% NA
Indica I  595 48.10% 7.10% 1.01% 43.87% NA
Indica II  465 46.90% 4.90% 0.86% 47.31% NA
Indica III  913 70.90% 0.80% 0.00% 28.37% NA
Indica Intermediate  786 59.30% 4.80% 0.51% 35.37% NA
Temperate Japonica  767 28.70% 66.00% 0.13% 5.22% NA
Tropical Japonica  504 88.30% 10.50% 0.00% 1.19% NA
Japonica Intermediate  241 71.00% 27.00% 0.00% 2.07% NA
VI/Aromatic  96 37.50% 20.80% 0.00% 41.67% NA
Intermediate  90 58.90% 30.00% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208286528 A -> C LOC_Os12g14500.1 downstream_gene_variant ; 4145.0bp to feature; MODIFIER silent_mutation Average:38.166; most accessible tissue: Callus, score: 78.845 N N N N
vg1208286528 A -> C LOC_Os12g14510.1 downstream_gene_variant ; 2480.0bp to feature; MODIFIER silent_mutation Average:38.166; most accessible tissue: Callus, score: 78.845 N N N N
vg1208286528 A -> C LOC_Os12g14520.1 downstream_gene_variant ; 1610.0bp to feature; MODIFIER silent_mutation Average:38.166; most accessible tissue: Callus, score: 78.845 N N N N
vg1208286528 A -> C LOC_Os12g14510-LOC_Os12g14520 intergenic_region ; MODIFIER silent_mutation Average:38.166; most accessible tissue: Callus, score: 78.845 N N N N
vg1208286528 A -> DEL N N silent_mutation Average:38.166; most accessible tissue: Callus, score: 78.845 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208286528 NA 6.26E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208286528 NA 3.05E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208286528 NA 1.11E-12 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 1.23E-07 9.89E-15 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 2.50E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 6.37E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 2.63E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 8.29E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 4.59E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 4.60E-08 1.56E-19 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 2.00E-11 7.08E-22 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 7.66E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 4.86E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 2.59E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 7.28E-10 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 1.20E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 4.46E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 4.00E-12 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 1.75E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 4.88E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 2.14E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 3.21E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 1.92E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 1.01E-08 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 4.75E-06 3.40E-07 mr1530_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 6.23E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 7.73E-17 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 6.08E-08 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 1.11E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 2.08E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 1.54E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 1.52E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 8.52E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286528 NA 5.44E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251