\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208286382:

Variant ID: vg1208286382 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8286382
Reference Allele: AAlternative Allele: G,C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTCTACGCACCCTCAACTCTTTGGGTTTTGCTTGGCTTGCCATGAAAGGAGAGGCAACCTCATATTGCCCTAAGCAGAATTTGAGAGGTTGAACTGTCC[A/G,C]
AAAGAGCAAGGTGATTTGTTGTTCTTCTCAACCTTCTTTTAGATTTGACTTATCAAATAGTTATGGTCTAAAGGTAATTATTTGAGAAAACGTTTTTAAG

Reverse complement sequence

CTTAAAAACGTTTTCTCAAATAATTACCTTTAGACCATAACTATTTGATAAGTCAAATCTAAAAGAAGGTTGAGAAGAACAACAAATCACCTTGCTCTTT[T/C,G]
GGACAGTTCAACCTCTCAAATTCTGCTTAGGGCAATATGAGGTTGCCTCTCCTTTCATGGCAAGCCAAGCAAAACCCAAAGAGTTGAGGGTGCGTAGAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 26.20% 0.97% 0.00% A: 16.82%
All Indica  2759 59.10% 36.30% 0.91% 0.00% A: 3.70%
All Japonica  1512 55.40% 3.60% 0.33% 0.00% A: 40.67%
Aus  269 33.10% 50.90% 3.72% 0.00% A: 12.27%
Indica I  595 48.20% 43.50% 1.68% 0.00% A: 6.55%
Indica II  465 45.80% 48.40% 1.51% 0.00% A: 4.30%
Indica III  913 71.60% 26.90% 0.66% 0.00% A: 0.77%
Indica Intermediate  786 60.70% 34.50% 0.25% 0.00% A: 4.58%
Temperate Japonica  767 28.90% 5.70% 0.52% 0.00% A: 64.80%
Tropical Japonica  504 88.30% 1.20% 0.00% 0.00% A: 10.52%
Japonica Intermediate  241 70.50% 2.10% 0.41% 0.00% A: 26.97%
VI/Aromatic  96 37.50% 37.50% 5.21% 0.00% A: 19.79%
Intermediate  90 60.00% 10.00% 1.11% 0.00% A: 28.89%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208286382 A -> C LOC_Os12g14500.1 downstream_gene_variant ; 3999.0bp to feature; MODIFIER silent_mutation Average:40.538; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N
vg1208286382 A -> C LOC_Os12g14510.1 downstream_gene_variant ; 2334.0bp to feature; MODIFIER silent_mutation Average:40.538; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N
vg1208286382 A -> C LOC_Os12g14520.1 downstream_gene_variant ; 1756.0bp to feature; MODIFIER silent_mutation Average:40.538; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N
vg1208286382 A -> C LOC_Os12g14510-LOC_Os12g14520 intergenic_region ; MODIFIER silent_mutation Average:40.538; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N
vg1208286382 A -> G LOC_Os12g14500.1 downstream_gene_variant ; 3999.0bp to feature; MODIFIER silent_mutation Average:40.538; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N
vg1208286382 A -> G LOC_Os12g14510.1 downstream_gene_variant ; 2334.0bp to feature; MODIFIER silent_mutation Average:40.538; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N
vg1208286382 A -> G LOC_Os12g14520.1 downstream_gene_variant ; 1756.0bp to feature; MODIFIER silent_mutation Average:40.538; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N
vg1208286382 A -> G LOC_Os12g14510-LOC_Os12g14520 intergenic_region ; MODIFIER silent_mutation Average:40.538; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208286382 NA 5.05E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208286382 NA 3.05E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208286382 NA 3.57E-13 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 1.23E-07 9.89E-15 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 2.50E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 6.37E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 2.63E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 8.29E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 2.75E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 4.59E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 2.15E-08 5.21E-20 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 2.00E-11 7.08E-22 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 7.66E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 1.92E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 2.59E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 7.28E-10 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 9.39E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 2.99E-16 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 4.00E-12 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 4.88E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 5.03E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 3.48E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 2.77E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 4.13E-06 3.30E-07 mr1530_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 3.58E-17 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 3.84E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 7.18E-18 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 1.05E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 1.11E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 3.19E-08 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 1.06E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 6.05E-17 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 3.62E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 3.88E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 8.52E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208286382 NA 5.44E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251