Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208281275:

Variant ID: vg1208281275 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8281275
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 31. )

Flanking Sequence (100 bp) in Reference Genome:


CCAAAATGCATTGGGGGGAGAAGACTGCGGCAGCGGCAGATGATGTCGGGCTTGGGGGATGGACAGTTTGTGGCAGTGTTGGCAATGCTGCTGATTCTGT[G/A]
GAGCAGGGACACGCAAGAATGCTGGCTAAGCACCGACGACGACAAAGACGCGCACGAGCTGAGGAATGATGCCGCGCCGCGCGTGAAGGACGGTGCTCGA

Reverse complement sequence

TCGAGCACCGTCCTTCACGCGCGGCGCGGCATCATTCCTCAGCTCGTGCGCGTCTTTGTCGTCGTCGGTGCTTAGCCAGCATTCTTGCGTGTCCCTGCTC[C/T]
ACAGAATCAGCAGCATTGCCAACACTGCCACAAACTGTCCATCCCCCAAGCCCGACATCATCTGCCGCTGCCGCAGTCTTCTCCCCCCAATGCATTTTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 27.30% 2.75% 15.00% NA
All Indica  2759 51.80% 45.10% 1.34% 1.78% NA
All Japonica  1512 55.80% 1.50% 4.03% 38.62% NA
Aus  269 64.70% 1.50% 10.41% 23.42% NA
Indica I  595 65.70% 29.20% 3.36% 1.68% NA
Indica II  465 60.20% 37.40% 1.29% 1.08% NA
Indica III  913 39.30% 58.50% 0.00% 2.19% NA
Indica Intermediate  786 50.60% 46.20% 1.40% 1.78% NA
Temperate Japonica  767 72.40% 0.50% 3.52% 23.60% NA
Tropical Japonica  504 38.30% 3.60% 4.96% 53.17% NA
Japonica Intermediate  241 39.80% 0.40% 3.73% 56.02% NA
VI/Aromatic  96 93.80% 1.00% 1.04% 4.17% NA
Intermediate  90 65.60% 21.10% 3.33% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208281275 G -> DEL LOC_Os12g14500.1 N frameshift_variant Average:68.056; most accessible tissue: Minghui63 flag leaf, score: 90.593 N N N N
vg1208281275 G -> A LOC_Os12g14500.1 stop_gained ; p.Trp94*; HIGH stop_gained Average:68.056; most accessible tissue: Minghui63 flag leaf, score: 90.593 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1208281275 G A 0.0 -0.01 0.0 0.02 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208281275 NA 4.91E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208281275 NA 9.95E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208281275 NA 2.50E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 2.77E-06 1.19E-13 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 7.18E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 9.74E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 1.88E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 3.71E-07 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 2.10E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 9.11E-07 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 2.93E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 5.28E-06 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 1.16E-07 1.83E-18 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 1.76E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 1.43E-10 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 1.58E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 2.33E-09 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 7.83E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 1.33E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 6.50E-06 NA mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 6.46E-06 2.95E-09 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 1.07E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 1.99E-06 NA mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 2.07E-06 3.47E-09 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 1.33E-08 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 5.06E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 8.28E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 NA 9.77E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 1.44E-06 2.03E-08 mr1910_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208281275 1.62E-07 7.63E-08 mr1910_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251