\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208278474:

Variant ID: vg1208278474 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8278474
Reference Allele: TAlternative Allele: G,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, T: 0.42, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


ATATTCCCTCCCTCCGTTTTTAGATATACGACGCTATTGACTTTTAGTGCAAATATAAAAAATTAAGTCATGCATATTTAAAGTTCCTTTAATCATAAAA[T/G,A]
AGTAAATTGTACTGCAGGTACACGAATTTATCAAGTGGGGATAATCTATTATAAAATATTTATTTTGGTATACGAACTTATTAGATGCGTGGAAACCAAG

Reverse complement sequence

CTTGGTTTCCACGCATCTAATAAGTTCGTATACCAAAATAAATATTTTATAATAGATTATCCCCACTTGATAAATTCGTGTACCTGCAGTACAATTTACT[A/C,T]
TTTTATGATTAAAGGAACTTTAAATATGCATGACTTAATTTTTTATATTTGCACTAAAAGTCAATAGCGTCGTATATCTAAAAACGGAGGGAGGGAATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.70% 17.60% 9.08% 24.12% A: 1.46%
All Indica  2759 74.20% 4.20% 11.31% 9.50% A: 0.80%
All Japonica  1512 4.20% 41.90% 1.19% 52.65% NA
Aus  269 34.90% 14.50% 23.05% 13.75% A: 13.75%
Indica I  595 67.20% 7.70% 18.15% 6.55% A: 0.34%
Indica II  465 66.20% 5.60% 12.26% 15.05% A: 0.86%
Indica III  913 84.10% 0.70% 7.34% 7.01% A: 0.88%
Indica Intermediate  786 72.80% 4.70% 10.18% 11.32% A: 1.02%
Temperate Japonica  767 5.20% 66.60% 1.56% 26.60% NA
Tropical Japonica  504 4.20% 10.90% 0.40% 84.52% NA
Japonica Intermediate  241 1.20% 28.20% 1.66% 68.88% NA
VI/Aromatic  96 18.80% 20.80% 27.08% 25.00% A: 8.33%
Intermediate  90 34.40% 27.80% 12.22% 23.33% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208278474 T -> A LOC_Os12g14510.1 upstream_gene_variant ; 4907.0bp to feature; MODIFIER silent_mutation Average:31.284; most accessible tissue: Callus, score: 70.628 N N N N
vg1208278474 T -> A LOC_Os12g14490.1 downstream_gene_variant ; 4368.0bp to feature; MODIFIER silent_mutation Average:31.284; most accessible tissue: Callus, score: 70.628 N N N N
vg1208278474 T -> A LOC_Os12g14500.1 intron_variant ; MODIFIER silent_mutation Average:31.284; most accessible tissue: Callus, score: 70.628 N N N N
vg1208278474 T -> DEL N N silent_mutation Average:31.284; most accessible tissue: Callus, score: 70.628 N N N N
vg1208278474 T -> G LOC_Os12g14510.1 upstream_gene_variant ; 4907.0bp to feature; MODIFIER silent_mutation Average:31.284; most accessible tissue: Callus, score: 70.628 N N N N
vg1208278474 T -> G LOC_Os12g14490.1 downstream_gene_variant ; 4368.0bp to feature; MODIFIER silent_mutation Average:31.284; most accessible tissue: Callus, score: 70.628 N N N N
vg1208278474 T -> G LOC_Os12g14500.1 intron_variant ; MODIFIER silent_mutation Average:31.284; most accessible tissue: Callus, score: 70.628 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208278474 NA 8.09E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208278474 NA 1.26E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208278474 4.99E-06 1.18E-14 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 4.18E-07 2.27E-14 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 8.48E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 1.38E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 1.79E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 4.39E-08 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 7.25E-06 mr1558 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 1.15E-07 1.17E-19 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 1.59E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 3.24E-10 4.14E-21 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 5.15E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 1.91E-10 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 1.41E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 9.96E-12 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 1.84E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 2.15E-06 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 7.41E-06 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 5.33E-06 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 3.69E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 8.40E-06 mr1284_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 8.16E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 5.71E-07 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 8.04E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 4.50E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 2.00E-06 mr1494_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 1.37E-07 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 1.20E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 3.73E-06 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 3.27E-07 mr1616_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 3.41E-06 mr1621_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 1.73E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 3.30E-07 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 4.67E-07 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 9.82E-06 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 9.80E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 8.78E-07 4.66E-11 mr1864_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 3.05E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 1.11E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208278474 NA 3.16E-06 mr1994_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251