\
| Variant ID: vg1208206256 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8206256 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AGAGTATTAAGGTATCTTAGCCGATTACAAAAATTTCTAGGTCCTATTACACAAAAGTTATTGAGACAAGTACAGCTGGATAGCCGAAATAGCCCTTTGC[G/C]
TAATTTGTTCGACTTCTTCAATGGCTTGGGCATCTTGAGCATCAGTTCCAGGAATGATCTTCAAAGACTTGGTCAGATCAGCAACATTCTTGATAGCCTA
TAGGCTATCAAGAATGTTGCTGATCTGACCAAGTCTTTGAAGATCATTCCTGGAACTGATGCTCAAGATGCCCAAGCCATTGAAGAAGTCGAACAAATTA[C/G]
GCAAAGGGCTATTTCGGCTATCCAGCTGTACTTGTCTCAATAACTTTTGTGTAATAGGACCTAGAAATTTTTGTAATCGGCTAAGATACCTTAATACTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.20% | 19.60% | 4.17% | 20.08% | NA |
| All Indica | 2759 | 85.20% | 3.80% | 4.10% | 6.81% | NA |
| All Japonica | 1512 | 8.10% | 48.60% | 1.12% | 42.13% | NA |
| Aus | 269 | 37.50% | 14.50% | 21.93% | 26.02% | NA |
| Indica I | 595 | 78.70% | 7.60% | 4.20% | 9.58% | NA |
| Indica II | 465 | 89.50% | 4.50% | 2.15% | 3.87% | NA |
| Indica III | 913 | 89.00% | 0.80% | 4.16% | 6.02% | NA |
| Indica Intermediate | 786 | 83.30% | 4.20% | 5.09% | 7.38% | NA |
| Temperate Japonica | 767 | 7.40% | 72.80% | 0.78% | 19.04% | NA |
| Tropical Japonica | 504 | 7.90% | 18.30% | 1.59% | 72.22% | NA |
| Japonica Intermediate | 241 | 10.80% | 35.30% | 1.24% | 52.70% | NA |
| VI/Aromatic | 96 | 36.50% | 19.80% | 5.21% | 38.54% | NA |
| Intermediate | 90 | 47.80% | 30.00% | 3.33% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208206256 | G -> C | LOC_Os12g14374.1 | downstream_gene_variant ; 1281.0bp to feature; MODIFIER | silent_mutation | Average:29.897; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg1208206256 | G -> C | LOC_Os12g14390.1 | downstream_gene_variant ; 98.0bp to feature; MODIFIER | silent_mutation | Average:29.897; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg1208206256 | G -> C | LOC_Os12g14374-LOC_Os12g14390 | intergenic_region ; MODIFIER | silent_mutation | Average:29.897; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg1208206256 | G -> DEL | N | N | silent_mutation | Average:29.897; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208206256 | NA | 5.00E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1208206256 | NA | 5.44E-10 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1208206256 | 3.21E-09 | 1.14E-14 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 3.99E-12 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 2.52E-15 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 4.57E-09 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | 2.70E-06 | 3.30E-18 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 1.24E-10 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 9.35E-13 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 9.48E-08 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | 3.09E-06 | 2.15E-18 | mr1056 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 3.33E-09 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 2.89E-21 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | 1.05E-15 | 7.83E-23 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | 1.56E-08 | 3.78E-19 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 3.87E-23 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 2.57E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 1.27E-12 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 9.49E-09 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | 5.83E-06 | 2.66E-22 | mr1013_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 8.05E-11 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 7.49E-21 | mr1031_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 7.48E-13 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 3.27E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 5.65E-09 | mr1361_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 2.76E-06 | mr1554_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 3.63E-12 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 6.46E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 2.84E-11 | mr1879_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208206256 | NA | 5.23E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |