\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208206256:

Variant ID: vg1208206256 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8206256
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAGTATTAAGGTATCTTAGCCGATTACAAAAATTTCTAGGTCCTATTACACAAAAGTTATTGAGACAAGTACAGCTGGATAGCCGAAATAGCCCTTTGC[G/C]
TAATTTGTTCGACTTCTTCAATGGCTTGGGCATCTTGAGCATCAGTTCCAGGAATGATCTTCAAAGACTTGGTCAGATCAGCAACATTCTTGATAGCCTA

Reverse complement sequence

TAGGCTATCAAGAATGTTGCTGATCTGACCAAGTCTTTGAAGATCATTCCTGGAACTGATGCTCAAGATGCCCAAGCCATTGAAGAAGTCGAACAAATTA[C/G]
GCAAAGGGCTATTTCGGCTATCCAGCTGTACTTGTCTCAATAACTTTTGTGTAATAGGACCTAGAAATTTTTGTAATCGGCTAAGATACCTTAATACTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 19.60% 4.17% 20.08% NA
All Indica  2759 85.20% 3.80% 4.10% 6.81% NA
All Japonica  1512 8.10% 48.60% 1.12% 42.13% NA
Aus  269 37.50% 14.50% 21.93% 26.02% NA
Indica I  595 78.70% 7.60% 4.20% 9.58% NA
Indica II  465 89.50% 4.50% 2.15% 3.87% NA
Indica III  913 89.00% 0.80% 4.16% 6.02% NA
Indica Intermediate  786 83.30% 4.20% 5.09% 7.38% NA
Temperate Japonica  767 7.40% 72.80% 0.78% 19.04% NA
Tropical Japonica  504 7.90% 18.30% 1.59% 72.22% NA
Japonica Intermediate  241 10.80% 35.30% 1.24% 52.70% NA
VI/Aromatic  96 36.50% 19.80% 5.21% 38.54% NA
Intermediate  90 47.80% 30.00% 3.33% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208206256 G -> C LOC_Os12g14374.1 downstream_gene_variant ; 1281.0bp to feature; MODIFIER silent_mutation Average:29.897; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg1208206256 G -> C LOC_Os12g14390.1 downstream_gene_variant ; 98.0bp to feature; MODIFIER silent_mutation Average:29.897; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg1208206256 G -> C LOC_Os12g14374-LOC_Os12g14390 intergenic_region ; MODIFIER silent_mutation Average:29.897; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg1208206256 G -> DEL N N silent_mutation Average:29.897; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208206256 NA 5.00E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208206256 NA 5.44E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208206256 3.21E-09 1.14E-14 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 3.99E-12 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 2.52E-15 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 4.57E-09 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 2.70E-06 3.30E-18 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 1.24E-10 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 9.35E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 9.48E-08 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 3.09E-06 2.15E-18 mr1056 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 3.33E-09 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 2.89E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 1.05E-15 7.83E-23 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 1.56E-08 3.78E-19 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 3.87E-23 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 2.57E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 1.27E-12 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 9.49E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 5.83E-06 2.66E-22 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 8.05E-11 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 7.49E-21 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 7.48E-13 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 3.27E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 5.65E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 2.76E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 3.63E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 6.46E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 2.84E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208206256 NA 5.23E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251