\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208201103:

Variant ID: vg1208201103 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8201103
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


CTATAGTGGGATTCATGAGATGAAATTGTCTGATCTAACATCGATCAAGCAAAAGCATGATGAACCAGTGCATGAGTATATTCAGAGATTCAGGGAGATG[G/A]
GAAATAAGTGTTACAGCTTGAGTTTGACTGATGCCCAGTTAGCCGATTTGGCTTTTTAGGGTATGATTGCTCTAATTAAGGAGAAGTTCTCATATGAAGA

Reverse complement sequence

TCTTCATATGAGAACTTCTCCTTAATTAGAGCAATCATACCCTAAAAAGCCAAATCGGCTAACTGGGCATCAGTCAAACTCAAGCTGTAACACTTATTTC[C/T]
CATCTCCCTGAATCTCTGAATATACTCATGCACTGGTTCATCATGCTTTTGCTTGATCGATGTTAGATCAGACAATTTCATCTCATGAATCCCACTATAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.10% 19.30% 1.50% 13.12% NA
All Indica  2759 96.10% 3.60% 0.22% 0.11% NA
All Japonica  1512 7.80% 48.10% 4.10% 39.95% NA
Aus  269 85.10% 14.50% 0.37% 0.00% NA
Indica I  595 92.40% 7.20% 0.34% 0.00% NA
Indica II  465 95.30% 4.30% 0.22% 0.22% NA
Indica III  913 99.20% 0.70% 0.00% 0.11% NA
Indica Intermediate  786 95.70% 3.80% 0.38% 0.13% NA
Temperate Japonica  767 8.00% 72.10% 4.30% 15.65% NA
Tropical Japonica  504 8.30% 18.30% 3.77% 69.64% NA
Japonica Intermediate  241 6.20% 34.40% 4.15% 55.19% NA
VI/Aromatic  96 76.00% 18.80% 2.08% 3.12% NA
Intermediate  90 58.90% 30.00% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208201103 G -> DEL N N silent_mutation Average:44.818; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg1208201103 G -> A LOC_Os12g14374.1 intron_variant ; MODIFIER silent_mutation Average:44.818; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208201103 NA 3.09E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208201103 NA 1.21E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208201103 1.16E-08 2.51E-14 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 2.42E-12 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 7.37E-15 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 2.50E-08 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 5.72E-06 6.53E-18 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 9.89E-10 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 6.30E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 2.41E-07 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 3.59E-06 3.39E-18 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 1.20E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 4.62E-23 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 3.35E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 7.28E-14 5.66E-22 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 2.88E-07 4.79E-19 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 1.80E-25 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 1.65E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 1.77E-13 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 4.23E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 6.43E-07 2.07E-23 mr1013_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 5.26E-11 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 1.89E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 1.21E-06 7.02E-22 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 4.36E-13 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 4.21E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 5.47E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 1.20E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 8.59E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 3.01E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 7.86E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208201103 NA 7.45E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251