\
| Variant ID: vg1208201103 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8201103 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 277. )
CTATAGTGGGATTCATGAGATGAAATTGTCTGATCTAACATCGATCAAGCAAAAGCATGATGAACCAGTGCATGAGTATATTCAGAGATTCAGGGAGATG[G/A]
GAAATAAGTGTTACAGCTTGAGTTTGACTGATGCCCAGTTAGCCGATTTGGCTTTTTAGGGTATGATTGCTCTAATTAAGGAGAAGTTCTCATATGAAGA
TCTTCATATGAGAACTTCTCCTTAATTAGAGCAATCATACCCTAAAAAGCCAAATCGGCTAACTGGGCATCAGTCAAACTCAAGCTGTAACACTTATTTC[C/T]
CATCTCCCTGAATCTCTGAATATACTCATGCACTGGTTCATCATGCTTTTGCTTGATCGATGTTAGATCAGACAATTTCATCTCATGAATCCCACTATAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.10% | 19.30% | 1.50% | 13.12% | NA |
| All Indica | 2759 | 96.10% | 3.60% | 0.22% | 0.11% | NA |
| All Japonica | 1512 | 7.80% | 48.10% | 4.10% | 39.95% | NA |
| Aus | 269 | 85.10% | 14.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 92.40% | 7.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.30% | 0.22% | 0.22% | NA |
| Indica III | 913 | 99.20% | 0.70% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 95.70% | 3.80% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 8.00% | 72.10% | 4.30% | 15.65% | NA |
| Tropical Japonica | 504 | 8.30% | 18.30% | 3.77% | 69.64% | NA |
| Japonica Intermediate | 241 | 6.20% | 34.40% | 4.15% | 55.19% | NA |
| VI/Aromatic | 96 | 76.00% | 18.80% | 2.08% | 3.12% | NA |
| Intermediate | 90 | 58.90% | 30.00% | 0.00% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208201103 | G -> DEL | N | N | silent_mutation | Average:44.818; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 | N | N | N | N |
| vg1208201103 | G -> A | LOC_Os12g14374.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.818; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208201103 | NA | 3.09E-11 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1208201103 | NA | 1.21E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1208201103 | 1.16E-08 | 2.51E-14 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 2.42E-12 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 7.37E-15 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 2.50E-08 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | 5.72E-06 | 6.53E-18 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 9.89E-10 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 6.30E-13 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 2.41E-07 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | 3.59E-06 | 3.39E-18 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 1.20E-08 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 4.62E-23 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 3.35E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | 7.28E-14 | 5.66E-22 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | 2.88E-07 | 4.79E-19 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 1.80E-25 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 1.65E-09 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 1.77E-13 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 4.23E-09 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | 6.43E-07 | 2.07E-23 | mr1013_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 5.26E-11 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 1.89E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | 1.21E-06 | 7.02E-22 | mr1031_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 4.36E-13 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 4.21E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 5.47E-06 | mr1554_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 1.20E-07 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 8.59E-06 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 3.01E-12 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 7.86E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208201103 | NA | 7.45E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |