\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208192471:

Variant ID: vg1208192471 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8192471
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, A: 0.25, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


GACAGGACTCTTCGCATAACCCCATCTAGCCAAGCACACCACACCTCAGGTTTCACCCCCGTCCCCAGCGGGCAACGGGCAGTCCCCTCTCGTGCCTAGG[A/T]
GAATCCGGAAGCAACAGAGGCCGTCGCAGGGCCCGCCCGGCTCCATCACGCCCACCCTTGCCTGGATGCGTCAGCTAGAGGAAAGCTACACTACAAGCCC

Reverse complement sequence

GGGCTTGTAGTGTAGCTTTCCTCTAGCTGACGCATCCAGGCAAGGGTGGGCGTGATGGAGCCGGGCGGGCCCTGCGACGGCCTCTGTTGCTTCCGGATTC[T/A]
CCTAGGCACGAGAGGGGACTGCCCGTTGCCCGCTGGGGACGGGGGTGAAACCTGAGGTGTGGTGTGCTTGGCTAGATGGGGTTATGCGAAGAGTCCTGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.90% 19.20% 3.09% 43.88% NA
All Indica  2759 50.90% 3.80% 3.77% 41.61% NA
All Japonica  1512 2.90% 47.40% 1.46% 48.28% NA
Aus  269 33.50% 14.10% 2.60% 49.81% NA
Indica I  595 31.10% 6.90% 2.69% 59.33% NA
Indica II  465 40.40% 4.30% 3.01% 52.26% NA
Indica III  913 68.60% 1.00% 5.59% 24.86% NA
Indica Intermediate  786 51.40% 4.30% 2.93% 41.35% NA
Temperate Japonica  767 1.40% 71.70% 1.17% 25.68% NA
Tropical Japonica  504 5.40% 16.90% 1.98% 75.79% NA
Japonica Intermediate  241 2.50% 33.60% 1.24% 62.66% NA
VI/Aromatic  96 33.30% 20.80% 11.46% 34.38% NA
Intermediate  90 34.40% 31.10% 2.22% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208192471 A -> DEL N N silent_mutation Average:37.328; most accessible tissue: Minghui63 young leaf, score: 79.549 N N N N
vg1208192471 A -> T LOC_Os12g14374.1 upstream_gene_variant ; 1591.0bp to feature; MODIFIER silent_mutation Average:37.328; most accessible tissue: Minghui63 young leaf, score: 79.549 N N N N
vg1208192471 A -> T LOC_Os12g14360-LOC_Os12g14374 intergenic_region ; MODIFIER silent_mutation Average:37.328; most accessible tissue: Minghui63 young leaf, score: 79.549 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208192471 NA 8.69E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208192471 NA 1.89E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208192471 9.73E-08 9.50E-13 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 1.01E-11 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 1.64E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 4.38E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 9.63E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 4.24E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 6.21E-06 NA mr1952 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 6.54E-06 6.54E-06 mr1952 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 2.42E-11 2.99E-18 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 2.78E-06 4.72E-18 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 8.23E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 1.43E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 8.87E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 5.81E-17 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 3.36E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 1.10E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 8.08E-16 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 7.04E-11 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 9.89E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 3.07E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 6.48E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 9.94E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208192471 NA 4.24E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251