\
| Variant ID: vg1208105826 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8105826 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GAGTTATGAACCAAATTCAGTTGCAATTAATAAATGCTAGCTTCTGCTGGAGTTTAAGCTTTGCTCAAACTTAATTGGTATAGTGGTTTAGCCCAAGAGG[C/T]
AATATAAAAATATTAATTGCGGGAGACATTGAAGTAACAATTGATGAAAAGTACATAATATGCACCATTCCAAATTTGCATGTACAGACTTGCATATATA
TATATATGCAAGTCTGTACATGCAAATTTGGAATGGTGCATATTATGTACTTTTCATCAATTGTTACTTCAATGTCTCCCGCAATTAATATTTTTATATT[G/A]
CCTCTTGGGCTAAACCACTATACCAATTAAGTTTGAGCAAAGCTTAAACTCCAGCAGAAGCTAGCATTTATTAATTGCAACTGAATTTGGTTCATAACTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.90% | 16.00% | 0.21% | 23.93% | NA |
| All Indica | 2759 | 85.10% | 2.60% | 0.14% | 12.11% | NA |
| All Japonica | 1512 | 6.50% | 42.30% | 0.40% | 50.73% | NA |
| Aus | 269 | 97.40% | 1.50% | 0.00% | 1.12% | NA |
| Indica I | 595 | 82.00% | 4.50% | 0.00% | 13.45% | NA |
| Indica II | 465 | 90.30% | 3.20% | 0.00% | 6.45% | NA |
| Indica III | 913 | 84.20% | 1.00% | 0.22% | 14.57% | NA |
| Indica Intermediate | 786 | 85.50% | 2.70% | 0.25% | 11.58% | NA |
| Temperate Japonica | 767 | 7.40% | 67.90% | 0.26% | 24.38% | NA |
| Tropical Japonica | 504 | 5.80% | 11.10% | 0.60% | 82.54% | NA |
| Japonica Intermediate | 241 | 5.40% | 26.10% | 0.41% | 68.05% | NA |
| VI/Aromatic | 96 | 75.00% | 18.80% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 52.20% | 24.40% | 0.00% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208105826 | C -> DEL | N | N | silent_mutation | Average:31.156; most accessible tissue: Callus, score: 52.537 | N | N | N | N |
| vg1208105826 | C -> T | LOC_Os12g14250.1 | upstream_gene_variant ; 1719.0bp to feature; MODIFIER | silent_mutation | Average:31.156; most accessible tissue: Callus, score: 52.537 | N | N | N | N |
| vg1208105826 | C -> T | LOC_Os12g14250-LOC_Os12g14260 | intergenic_region ; MODIFIER | silent_mutation | Average:31.156; most accessible tissue: Callus, score: 52.537 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208105826 | NA | 8.45E-12 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1208105826 | NA | 5.49E-12 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1208105826 | 1.33E-11 | 2.95E-16 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | 7.63E-07 | 4.25E-14 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 2.93E-07 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 3.73E-14 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 7.65E-09 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 4.16E-06 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 4.45E-14 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 9.65E-08 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 3.86E-08 | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 4.34E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 3.22E-07 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 4.84E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | 1.60E-15 | 8.92E-23 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | 9.96E-11 | 2.87E-21 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 8.96E-22 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 1.32E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 6.54E-14 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 4.75E-09 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 1.58E-21 | mr1013_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 1.27E-09 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 6.94E-08 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | 2.71E-06 | 6.57E-22 | mr1031_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 8.59E-12 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 5.56E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 1.29E-07 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208105826 | NA | 1.19E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |