\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208105826:

Variant ID: vg1208105826 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8105826
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGTTATGAACCAAATTCAGTTGCAATTAATAAATGCTAGCTTCTGCTGGAGTTTAAGCTTTGCTCAAACTTAATTGGTATAGTGGTTTAGCCCAAGAGG[C/T]
AATATAAAAATATTAATTGCGGGAGACATTGAAGTAACAATTGATGAAAAGTACATAATATGCACCATTCCAAATTTGCATGTACAGACTTGCATATATA

Reverse complement sequence

TATATATGCAAGTCTGTACATGCAAATTTGGAATGGTGCATATTATGTACTTTTCATCAATTGTTACTTCAATGTCTCCCGCAATTAATATTTTTATATT[G/A]
CCTCTTGGGCTAAACCACTATACCAATTAAGTTTGAGCAAAGCTTAAACTCCAGCAGAAGCTAGCATTTATTAATTGCAACTGAATTTGGTTCATAACTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 16.00% 0.21% 23.93% NA
All Indica  2759 85.10% 2.60% 0.14% 12.11% NA
All Japonica  1512 6.50% 42.30% 0.40% 50.73% NA
Aus  269 97.40% 1.50% 0.00% 1.12% NA
Indica I  595 82.00% 4.50% 0.00% 13.45% NA
Indica II  465 90.30% 3.20% 0.00% 6.45% NA
Indica III  913 84.20% 1.00% 0.22% 14.57% NA
Indica Intermediate  786 85.50% 2.70% 0.25% 11.58% NA
Temperate Japonica  767 7.40% 67.90% 0.26% 24.38% NA
Tropical Japonica  504 5.80% 11.10% 0.60% 82.54% NA
Japonica Intermediate  241 5.40% 26.10% 0.41% 68.05% NA
VI/Aromatic  96 75.00% 18.80% 0.00% 6.25% NA
Intermediate  90 52.20% 24.40% 0.00% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208105826 C -> DEL N N silent_mutation Average:31.156; most accessible tissue: Callus, score: 52.537 N N N N
vg1208105826 C -> T LOC_Os12g14250.1 upstream_gene_variant ; 1719.0bp to feature; MODIFIER silent_mutation Average:31.156; most accessible tissue: Callus, score: 52.537 N N N N
vg1208105826 C -> T LOC_Os12g14250-LOC_Os12g14260 intergenic_region ; MODIFIER silent_mutation Average:31.156; most accessible tissue: Callus, score: 52.537 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208105826 NA 8.45E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208105826 NA 5.49E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208105826 1.33E-11 2.95E-16 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 7.63E-07 4.25E-14 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 2.93E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 3.73E-14 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 7.65E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 4.16E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 4.45E-14 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 9.65E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 3.86E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 4.34E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 3.22E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 4.84E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 1.60E-15 8.92E-23 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 9.96E-11 2.87E-21 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 8.96E-22 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 1.32E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 6.54E-14 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 4.75E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 1.58E-21 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 1.27E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 6.94E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 2.71E-06 6.57E-22 mr1031_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 8.59E-12 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 5.56E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 1.29E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208105826 NA 1.19E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251